Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636170_at:

>probe:Drosophila_2:1636170_at:354:639; Interrogation_Position=1528; Antisense; TCGGCGCTGGAGAGAACCACTTCGA
>probe:Drosophila_2:1636170_at:471:205; Interrogation_Position=1567; Antisense; AAGCGGGAGGCATTGTTTGCCTACT
>probe:Drosophila_2:1636170_at:482:591; Interrogation_Position=1591; Antisense; TGGGATCCACTACCCTATTGCGCAT
>probe:Drosophila_2:1636170_at:442:721; Interrogation_Position=1608; Antisense; TTGCGCATACTATCATTTCCAGCTG
>probe:Drosophila_2:1636170_at:548:283; Interrogation_Position=1630; Antisense; CTGCCCCTGAAGAACGTGAAGCTGT
>probe:Drosophila_2:1636170_at:658:377; Interrogation_Position=1647; Antisense; GAAGCTGTTTTTGCAGCGCCGGAAT
>probe:Drosophila_2:1636170_at:645:235; Interrogation_Position=1669; Antisense; AATCGCAGCGCGACCAAAACCTTAT
>probe:Drosophila_2:1636170_at:258:33; Interrogation_Position=1702; Antisense; ATCACGGTGCCGGTTCATTGAACGG
>probe:Drosophila_2:1636170_at:371:711; Interrogation_Position=1715; Antisense; TTCATTGAACGGAGCGGCCGGAGCT
>probe:Drosophila_2:1636170_at:109:555; Interrogation_Position=1740; Antisense; GGAGCCACTGCATCGGCTTTAAGCA
>probe:Drosophila_2:1636170_at:12:571; Interrogation_Position=1754; Antisense; GGCTTTAAGCATCGAACAGCAGCAT
>probe:Drosophila_2:1636170_at:154:645; Interrogation_Position=1778; Antisense; TCTAGCCTCTAGCATCCAGCATCAG
>probe:Drosophila_2:1636170_at:529:115; Interrogation_Position=1795; Antisense; AGCATCAGGCGTTTCTTTAGCGAGA
>probe:Drosophila_2:1636170_at:364:181; Interrogation_Position=2006; Antisense; AAAACAAACGTGTACCGCTCACACA

Paste this into a BLAST search page for me
TCGGCGCTGGAGAGAACCACTTCGAAAGCGGGAGGCATTGTTTGCCTACTTGGGATCCACTACCCTATTGCGCATTTGCGCATACTATCATTTCCAGCTGCTGCCCCTGAAGAACGTGAAGCTGTGAAGCTGTTTTTGCAGCGCCGGAATAATCGCAGCGCGACCAAAACCTTATATCACGGTGCCGGTTCATTGAACGGTTCATTGAACGGAGCGGCCGGAGCTGGAGCCACTGCATCGGCTTTAAGCAGGCTTTAAGCATCGAACAGCAGCATTCTAGCCTCTAGCATCCAGCATCAGAGCATCAGGCGTTTCTTTAGCGAGAAAAACAAACGTGTACCGCTCACACA

Full Affymetrix probeset data:

Annotations for 1636170_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime