FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636171_at:

>probe:Drosophila_2:1636171_at:652:41; Interrogation_Position=108; Antisense; ATCGGTGACCGAACAACTTAGCTCG
>probe:Drosophila_2:1636171_at:390:675; Interrogation_Position=126; Antisense; TAGCTCGGGTTCCTACCTATTTTCG
>probe:Drosophila_2:1636171_at:573:603; Interrogation_Position=14; Antisense; TGTTCGCATTGCTATTGATCTTGAC
>probe:Drosophila_2:1636171_at:616:701; Interrogation_Position=145; Antisense; TTTTCGTTCGAGTCCGCAGATGGCA
>probe:Drosophila_2:1636171_at:623:567; Interrogation_Position=166; Antisense; GGCACCTATCGCGAGGAACTGGGCA
>probe:Drosophila_2:1636171_at:137:595; Interrogation_Position=185; Antisense; TGGGCATAGTGAGCTCCGATTCGAA
>probe:Drosophila_2:1636171_at:479:39; Interrogation_Position=213; Antisense; ATCTGACGACGATCTCGAGGTGTCC
>probe:Drosophila_2:1636171_at:202:435; Interrogation_Position=229; Antisense; GAGGTGTCCGGTATTTATCGCTATA
>probe:Drosophila_2:1636171_at:334:689; Interrogation_Position=26; Antisense; TATTGATCTTGACTGGCTGCCAACT
>probe:Drosophila_2:1636171_at:439:559; Interrogation_Position=294; Antisense; GGACAAGAATGGCTTTCTGCCCCAC
>probe:Drosophila_2:1636171_at:201:299; Interrogation_Position=314; Antisense; CCCACGTTCGGTACATATCCAAAGG
>probe:Drosophila_2:1636171_at:17:195; Interrogation_Position=47; Antisense; AACTGCTGTGGAGTTGCCCCGCTGA
>probe:Drosophila_2:1636171_at:183:427; Interrogation_Position=70; Antisense; GAGTGTACTTCCATTAACGTGCCGG
>probe:Drosophila_2:1636171_at:726:289; Interrogation_Position=92; Antisense; CGGTGCCAATCCTCAAATCGGTGAC

Paste this into a BLAST search page for me
ATCGGTGACCGAACAACTTAGCTCGTAGCTCGGGTTCCTACCTATTTTCGTGTTCGCATTGCTATTGATCTTGACTTTTCGTTCGAGTCCGCAGATGGCAGGCACCTATCGCGAGGAACTGGGCATGGGCATAGTGAGCTCCGATTCGAAATCTGACGACGATCTCGAGGTGTCCGAGGTGTCCGGTATTTATCGCTATATATTGATCTTGACTGGCTGCCAACTGGACAAGAATGGCTTTCTGCCCCACCCCACGTTCGGTACATATCCAAAGGAACTGCTGTGGAGTTGCCCCGCTGAGAGTGTACTTCCATTAACGTGCCGGCGGTGCCAATCCTCAAATCGGTGAC

Full Affymetrix probeset data:

Annotations for 1636171_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720