FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636172_at:

>probe:Drosophila_2:1636172_at:321:607; Interrogation_Position=190; Antisense; TGATGATCCACCCATGGCTGACGGC
>probe:Drosophila_2:1636172_at:124:579; Interrogation_Position=224; Antisense; GGCCATGTATGCCACCAAGGTCATG
>probe:Drosophila_2:1636172_at:274:217; Interrogation_Position=255; Antisense; AAGTTCCGTGAGATCGGCCTGGCTA
>probe:Drosophila_2:1636172_at:729:581; Interrogation_Position=307; Antisense; TGGCGAAGCAGTCTAAGCCCTTGCA
>probe:Drosophila_2:1636172_at:222:659; Interrogation_Position=320; Antisense; TAAGCCCTTGCAGACTATTGATGAA
>probe:Drosophila_2:1636172_at:143:289; Interrogation_Position=431; Antisense; CGGGCCCCAAGTCGAAGATGCAGCA
>probe:Drosophila_2:1636172_at:558:265; Interrogation_Position=454; Antisense; CAGAGGGACCGGGATTCGAGCCAAA
>probe:Drosophila_2:1636172_at:575:517; Interrogation_Position=481; Antisense; GTGTGGATATATGCCATCGCCCGAT
>probe:Drosophila_2:1636172_at:174:45; Interrogation_Position=496; Antisense; ATCGCCCGATCGAAGTCTCTACTGA
>probe:Drosophila_2:1636172_at:325:499; Interrogation_Position=510; Antisense; GTCTCTACTGACTGCTGATGTTCGA
>probe:Drosophila_2:1636172_at:595:337; Interrogation_Position=598; Antisense; GTTGTAATGCTTGCGTTTTCCGTAG
>probe:Drosophila_2:1636172_at:702:545; Interrogation_Position=627; Antisense; GGATCCACGGACAATGTTTGACATG
>probe:Drosophila_2:1636172_at:19:481; Interrogation_Position=642; Antisense; GTTTGACATGTACCACCACATTGGG
>probe:Drosophila_2:1636172_at:625:163; Interrogation_Position=699; Antisense; AAATTTCTTGTACCACATTGCGATA

Paste this into a BLAST search page for me
TGATGATCCACCCATGGCTGACGGCGGCCATGTATGCCACCAAGGTCATGAAGTTCCGTGAGATCGGCCTGGCTATGGCGAAGCAGTCTAAGCCCTTGCATAAGCCCTTGCAGACTATTGATGAACGGGCCCCAAGTCGAAGATGCAGCACAGAGGGACCGGGATTCGAGCCAAAGTGTGGATATATGCCATCGCCCGATATCGCCCGATCGAAGTCTCTACTGAGTCTCTACTGACTGCTGATGTTCGAGTTGTAATGCTTGCGTTTTCCGTAGGGATCCACGGACAATGTTTGACATGGTTTGACATGTACCACCACATTGGGAAATTTCTTGTACCACATTGCGATA

Full Affymetrix probeset data:

Annotations for 1636172_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720