FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636174_at:

>probe:Drosophila_2:1636174_at:383:135; Interrogation_Position=215; Antisense; ACGCTGGTTGACGATGGTTTCGCCA
>probe:Drosophila_2:1636174_at:502:63; Interrogation_Position=228; Antisense; ATGGTTTCGCCATCTGGGAGTCGAG
>probe:Drosophila_2:1636174_at:421:341; Interrogation_Position=254; Antisense; GCTATACTGATTTATCTGGCCGAGA
>probe:Drosophila_2:1636174_at:604:223; Interrogation_Position=308; Antisense; AAGGATCCCCAGCAGAGAGCCGTGA
>probe:Drosophila_2:1636174_at:69:125; Interrogation_Position=339; Antisense; AGCGCCTGTTTTTCGATCTGAGTAC
>probe:Drosophila_2:1636174_at:328:417; Interrogation_Position=373; Antisense; GAGCTACGTGTACTACTACTATCCC
>probe:Drosophila_2:1636174_at:544:145; Interrogation_Position=387; Antisense; ACTACTATCCCCAGTTGTTCGAGGA
>probe:Drosophila_2:1636174_at:454:511; Interrogation_Position=413; Antisense; GTGAAGAAGCCAGCTGATCCCGATA
>probe:Drosophila_2:1636174_at:700:117; Interrogation_Position=424; Antisense; AGCTGATCCCGATAACCTCAAGAAG
>probe:Drosophila_2:1636174_at:591:443; Interrogation_Position=455; Antisense; GATGCTTTCGCTATGTTCAATACTC
>probe:Drosophila_2:1636174_at:1:603; Interrogation_Position=480; Antisense; TGTTGAAGGGTCAGCAGTACGCCGC
>probe:Drosophila_2:1636174_at:576:159; Interrogation_Position=510; Antisense; ACAAGTTGACTCTGGCCGATTTTGC
>probe:Drosophila_2:1636174_at:336:143; Interrogation_Position=648; Antisense; ACTGGGAGGGCTGCGAGTACTACAA
>probe:Drosophila_2:1636174_at:614:37; Interrogation_Position=727; Antisense; ATCTAATCTGTATCGACCTGTTTGA

Paste this into a BLAST search page for me
ACGCTGGTTGACGATGGTTTCGCCAATGGTTTCGCCATCTGGGAGTCGAGGCTATACTGATTTATCTGGCCGAGAAAGGATCCCCAGCAGAGAGCCGTGAAGCGCCTGTTTTTCGATCTGAGTACGAGCTACGTGTACTACTACTATCCCACTACTATCCCCAGTTGTTCGAGGAGTGAAGAAGCCAGCTGATCCCGATAAGCTGATCCCGATAACCTCAAGAAGGATGCTTTCGCTATGTTCAATACTCTGTTGAAGGGTCAGCAGTACGCCGCACAAGTTGACTCTGGCCGATTTTGCACTGGGAGGGCTGCGAGTACTACAAATCTAATCTGTATCGACCTGTTTGA

Full Affymetrix probeset data:

Annotations for 1636174_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720