Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636175_a_at:

>probe:Drosophila_2:1636175_a_at:9:39; Interrogation_Position=276; Antisense; ATCTGCCGTCCGTACATATTGAACA
>probe:Drosophila_2:1636175_a_at:341:129; Interrogation_Position=302; Antisense; ACCTTTGAGCTTAACGATGCCCTAA
>probe:Drosophila_2:1636175_a_at:348:189; Interrogation_Position=325; Antisense; AACAGGCGTCTCCTCGGAGAATCGA
>probe:Drosophila_2:1636175_a_at:663:451; Interrogation_Position=360; Antisense; GATCTCCACTGGGTGATGCCATTTT
>probe:Drosophila_2:1636175_a_at:476:15; Interrogation_Position=380; Antisense; ATTTTCGCGGCCAACGAGAGTTCCA
>probe:Drosophila_2:1636175_a_at:2:269; Interrogation_Position=473; Antisense; CAGGAAGCTCTGGTTTTTCGCAAAA
>probe:Drosophila_2:1636175_a_at:221:65; Interrogation_Position=506; Antisense; ATGGGATCCATGTGCTGCCAGGCAA
>probe:Drosophila_2:1636175_a_at:40:191; Interrogation_Position=640; Antisense; AACATTCTGTGTAGAGGGTCCTGTC
>probe:Drosophila_2:1636175_a_at:335:501; Interrogation_Position=662; Antisense; GTCGGTTTAGGATTCTGCTGCTTCA
>probe:Drosophila_2:1636175_a_at:694:621; Interrogation_Position=677; Antisense; TGCTGCTTCAGTTTGCCCAAAGATT
>probe:Drosophila_2:1636175_a_at:220:53; Interrogation_Position=731; Antisense; ATGAGGGCTTCCATAGACCACAAAT
>probe:Drosophila_2:1636175_a_at:3:265; Interrogation_Position=763; Antisense; CAGCAAGTCTCAGTACACCACAAAT
>probe:Drosophila_2:1636175_a_at:581:677; Interrogation_Position=796; Antisense; TAGTGACGCCAAGCTAACCGCCAAG
>probe:Drosophila_2:1636175_a_at:564:455; Interrogation_Position=832; Antisense; GATACTGGGATCAGCCTTTCTACTG

Paste this into a BLAST search page for me
ATCTGCCGTCCGTACATATTGAACAACCTTTGAGCTTAACGATGCCCTAAAACAGGCGTCTCCTCGGAGAATCGAGATCTCCACTGGGTGATGCCATTTTATTTTCGCGGCCAACGAGAGTTCCACAGGAAGCTCTGGTTTTTCGCAAAAATGGGATCCATGTGCTGCCAGGCAAAACATTCTGTGTAGAGGGTCCTGTCGTCGGTTTAGGATTCTGCTGCTTCATGCTGCTTCAGTTTGCCCAAAGATTATGAGGGCTTCCATAGACCACAAATCAGCAAGTCTCAGTACACCACAAATTAGTGACGCCAAGCTAACCGCCAAGGATACTGGGATCAGCCTTTCTACTG

Full Affymetrix probeset data:

Annotations for 1636175_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime