FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636176_at:

>probe:Drosophila_2:1636176_at:42:281; Interrogation_Position=1010; Antisense; CTCGGTGGCCAGCATTAAGTCAGGT
>probe:Drosophila_2:1636176_at:639:657; Interrogation_Position=1025; Antisense; TAAGTCAGGTTTCCAGGCTGTCACC
>probe:Drosophila_2:1636176_at:602:175; Interrogation_Position=1053; Antisense; AAACGTGCCGCCATACGAGCAAAAA
>probe:Drosophila_2:1636176_at:9:439; Interrogation_Position=564; Antisense; GAGGACAACAGCTCAACCTGGTTTG
>probe:Drosophila_2:1636176_at:678:375; Interrogation_Position=623; Antisense; GAAGCGGGTCTTCGAAATCATTCTC
>probe:Drosophila_2:1636176_at:180:127; Interrogation_Position=679; Antisense; AGCCAAAGTTCGTGATGCGACCGCC
>probe:Drosophila_2:1636176_at:661:559; Interrogation_Position=720; Antisense; GGAACCAAGAAGACCTCCTTTGCCA
>probe:Drosophila_2:1636176_at:717:693; Interrogation_Position=738; Antisense; TTTGCCAACTTCATGGACATTGCGA
>probe:Drosophila_2:1636176_at:668:487; Interrogation_Position=817; Antisense; GTACCAGTGGCTCCATGGACGGCAA
>probe:Drosophila_2:1636176_at:688:119; Interrogation_Position=847; Antisense; AGCTGATCATCAAGGGCCGTTTCCA
>probe:Drosophila_2:1636176_at:163:505; Interrogation_Position=891; Antisense; GTGCTGCGTCGCTACATCAAGGAGT
>probe:Drosophila_2:1636176_at:482:33; Interrogation_Position=906; Antisense; ATCAAGGAGTACGTCACCTGTCACA
>probe:Drosophila_2:1636176_at:5:299; Interrogation_Position=936; Antisense; CGCTCCCCGGAAACGATATTGCAGA
>probe:Drosophila_2:1636176_at:540:713; Interrogation_Position=975; Antisense; TTCTTCCTGCAGTGCGAATCCTGTG

Paste this into a BLAST search page for me
CTCGGTGGCCAGCATTAAGTCAGGTTAAGTCAGGTTTCCAGGCTGTCACCAAACGTGCCGCCATACGAGCAAAAAGAGGACAACAGCTCAACCTGGTTTGGAAGCGGGTCTTCGAAATCATTCTCAGCCAAAGTTCGTGATGCGACCGCCGGAACCAAGAAGACCTCCTTTGCCATTTGCCAACTTCATGGACATTGCGAGTACCAGTGGCTCCATGGACGGCAAAGCTGATCATCAAGGGCCGTTTCCAGTGCTGCGTCGCTACATCAAGGAGTATCAAGGAGTACGTCACCTGTCACACGCTCCCCGGAAACGATATTGCAGATTCTTCCTGCAGTGCGAATCCTGTG

Full Affymetrix probeset data:

Annotations for 1636176_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720