FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636177_at:

>probe:Drosophila_2:1636177_at:688:613; Interrogation_Position=7745; Antisense; TGCAGCTGCTTATCCGTTTGCCGAT
>probe:Drosophila_2:1636177_at:151:253; Interrogation_Position=7772; Antisense; CAACTCGCAGTTGTACCAGCAGTAT
>probe:Drosophila_2:1636177_at:564:485; Interrogation_Position=7784; Antisense; GTACCAGCAGTATCTAAGGCGCGAT
>probe:Drosophila_2:1636177_at:84:445; Interrogation_Position=7806; Antisense; GATGACTTTCACACGCGGATGATCT
>probe:Drosophila_2:1636177_at:246:547; Interrogation_Position=7822; Antisense; GGATGATCTTCAACCAGAGTCTACT
>probe:Drosophila_2:1636177_at:706:111; Interrogation_Position=7871; Antisense; AGCAGCCGGATATGGTCAACCGCCG
>probe:Drosophila_2:1636177_at:658:683; Interrogation_Position=7911; Antisense; TATCAACGCGCTGCACTGGGCATGC
>probe:Drosophila_2:1636177_at:638:593; Interrogation_Position=7927; Antisense; TGGGCATGCCCAAGCCGTATGACAT
>probe:Drosophila_2:1636177_at:63:305; Interrogation_Position=7955; Antisense; CCGGCAGTCATGGTTTTAGCAGTAC
>probe:Drosophila_2:1636177_at:112:37; Interrogation_Position=7999; Antisense; ATCTCCAAGGAGACGACCTGACGGG
>probe:Drosophila_2:1636177_at:185:567; Interrogation_Position=8027; Antisense; GGCAACTGGAACAGCATCGGGACCA
>probe:Drosophila_2:1636177_at:443:645; Interrogation_Position=8064; Antisense; TCTTCGACAGCAGCTACACAGCGAT
>probe:Drosophila_2:1636177_at:684:83; Interrogation_Position=8100; Antisense; AGTGGGCAGGCTTAGAACGGTTTCA
>probe:Drosophila_2:1636177_at:406:383; Interrogation_Position=8114; Antisense; GAACGGTTTCAAATCCACATGCAAA

Paste this into a BLAST search page for me
TGCAGCTGCTTATCCGTTTGCCGATCAACTCGCAGTTGTACCAGCAGTATGTACCAGCAGTATCTAAGGCGCGATGATGACTTTCACACGCGGATGATCTGGATGATCTTCAACCAGAGTCTACTAGCAGCCGGATATGGTCAACCGCCGTATCAACGCGCTGCACTGGGCATGCTGGGCATGCCCAAGCCGTATGACATCCGGCAGTCATGGTTTTAGCAGTACATCTCCAAGGAGACGACCTGACGGGGGCAACTGGAACAGCATCGGGACCATCTTCGACAGCAGCTACACAGCGATAGTGGGCAGGCTTAGAACGGTTTCAGAACGGTTTCAAATCCACATGCAAA

Full Affymetrix probeset data:

Annotations for 1636177_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720