FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636180_at:

>probe:Drosophila_2:1636180_at:537:381; Interrogation_Position=1014; Antisense; GAACGTCCTGAAGGTTTCCGGCAAG
>probe:Drosophila_2:1636180_at:504:427; Interrogation_Position=1063; Antisense; GAGATCAACGAAGCCTTTGCTGCCC
>probe:Drosophila_2:1636180_at:536:693; Interrogation_Position=1078; Antisense; TTTGCTGCCCAGACATTGGCTTGCG
>probe:Drosophila_2:1636180_at:638:447; Interrogation_Position=1105; Antisense; GATGCCCTGAAGTTGGATACCTCCA
>probe:Drosophila_2:1636180_at:261:195; Interrogation_Position=1130; Antisense; AACTGAATGTGAACGGAGGCGCCAT
>probe:Drosophila_2:1636180_at:74:347; Interrogation_Position=1190; Antisense; GCATCACTGGTCATCTGGTTCATGA
>probe:Drosophila_2:1636180_at:625:273; Interrogation_Position=1242; Antisense; CATTGGATCCGCGTGCATTGGTGGT
>probe:Drosophila_2:1636180_at:516:439; Interrogation_Position=1291; Antisense; GAGGCTGTCTAATCCTACAGCTTAA
>probe:Drosophila_2:1636180_at:717:79; Interrogation_Position=1322; Antisense; AGGTGCCCTGCATTTACACTTAAAT
>probe:Drosophila_2:1636180_at:536:159; Interrogation_Position=809; Antisense; ACAAGCTGCCTTCGCTGTTTAAGAA
>probe:Drosophila_2:1636180_at:434:573; Interrogation_Position=838; Antisense; GGCGTTGTGACTGCCGGAACAGCAT
>probe:Drosophila_2:1636180_at:317:565; Interrogation_Position=865; Antisense; GGAATCTGTGATGGTGCCTCCGCAG
>probe:Drosophila_2:1636180_at:511:75; Interrogation_Position=917; Antisense; AGGAGTACAACCTGAAGCCTCTGGC
>probe:Drosophila_2:1636180_at:525:629; Interrogation_Position=958; Antisense; TCCTTTGTCGGAGTCAAGCCTGAGA

Paste this into a BLAST search page for me
GAACGTCCTGAAGGTTTCCGGCAAGGAGATCAACGAAGCCTTTGCTGCCCTTTGCTGCCCAGACATTGGCTTGCGGATGCCCTGAAGTTGGATACCTCCAAACTGAATGTGAACGGAGGCGCCATGCATCACTGGTCATCTGGTTCATGACATTGGATCCGCGTGCATTGGTGGTGAGGCTGTCTAATCCTACAGCTTAAAGGTGCCCTGCATTTACACTTAAATACAAGCTGCCTTCGCTGTTTAAGAAGGCGTTGTGACTGCCGGAACAGCATGGAATCTGTGATGGTGCCTCCGCAGAGGAGTACAACCTGAAGCCTCTGGCTCCTTTGTCGGAGTCAAGCCTGAGA

Full Affymetrix probeset data:

Annotations for 1636180_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720