FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636181_at:

>probe:Drosophila_2:1636181_at:344:693; Interrogation_Position=1035; Antisense; TTTGCATGAGGCTTTCGCACCTGGG
>probe:Drosophila_2:1636181_at:622:465; Interrogation_Position=1117; Antisense; GATTGTGGCCATCTGTATTCCAACT
>probe:Drosophila_2:1636181_at:28:521; Interrogation_Position=1147; Antisense; GTGGACTTTCTCAGTGGCATCAGCA
>probe:Drosophila_2:1636181_at:467:695; Interrogation_Position=631; Antisense; TTTCCCGCATCATCTGTTTACCAGA
>probe:Drosophila_2:1636181_at:179:479; Interrogation_Position=646; Antisense; GTTTACCAGATCACGTCATCGCTGT
>probe:Drosophila_2:1636181_at:333:131; Interrogation_Position=675; Antisense; ACCTGTGGTCATTCCGGATCGCAAA
>probe:Drosophila_2:1636181_at:60:545; Interrogation_Position=690; Antisense; GGATCGCAAACTCTTCTGGGATTGG
>probe:Drosophila_2:1636181_at:484:309; Interrogation_Position=778; Antisense; CCAGATGAGTTTTCTCGGCGCAGAA
>probe:Drosophila_2:1636181_at:372:483; Interrogation_Position=831; Antisense; GTATCTGCCAGAAGGTGTGTCCACA
>probe:Drosophila_2:1636181_at:426:53; Interrogation_Position=856; Antisense; ATGCATCCGAGTGACTTTACAGCCG
>probe:Drosophila_2:1636181_at:668:421; Interrogation_Position=901; Antisense; GAGAATATGCTCATCCAGTATGGCT
>probe:Drosophila_2:1636181_at:349:91; Interrogation_Position=917; Antisense; AGTATGGCTTCGATGAGTCCTGCCT
>probe:Drosophila_2:1636181_at:300:247; Interrogation_Position=959; Antisense; AATTGGCGCGACATCCTTTCAAGGA
>probe:Drosophila_2:1636181_at:589:585; Interrogation_Position=986; Antisense; TGGAAAACAATATGCTCACCGCCCT

Paste this into a BLAST search page for me
TTTGCATGAGGCTTTCGCACCTGGGGATTGTGGCCATCTGTATTCCAACTGTGGACTTTCTCAGTGGCATCAGCATTTCCCGCATCATCTGTTTACCAGAGTTTACCAGATCACGTCATCGCTGTACCTGTGGTCATTCCGGATCGCAAAGGATCGCAAACTCTTCTGGGATTGGCCAGATGAGTTTTCTCGGCGCAGAAGTATCTGCCAGAAGGTGTGTCCACAATGCATCCGAGTGACTTTACAGCCGGAGAATATGCTCATCCAGTATGGCTAGTATGGCTTCGATGAGTCCTGCCTAATTGGCGCGACATCCTTTCAAGGATGGAAAACAATATGCTCACCGCCCT

Full Affymetrix probeset data:

Annotations for 1636181_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720