FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636183_at:

>probe:Drosophila_2:1636183_at:351:601; Interrogation_Position=16; Antisense; TGTTCCAAACTAACTCTTTTCCTGG
>probe:Drosophila_2:1636183_at:263:669; Interrogation_Position=234; Antisense; TACGGCATCCACTACCACAGAAAGG
>probe:Drosophila_2:1636183_at:416:277; Interrogation_Position=245; Antisense; CTACCACAGAAAGGACTCGCAGACG
>probe:Drosophila_2:1636183_at:102:325; Interrogation_Position=273; Antisense; GCGCAGGCGCAGGATAATCCGGATC
>probe:Drosophila_2:1636183_at:618:453; Interrogation_Position=285; Antisense; GATAATCCGGATCCGCAGGTTCAGG
>probe:Drosophila_2:1636183_at:397:501; Interrogation_Position=323; Antisense; GTCGTGGATTCGGTAGACGCAGATT
>probe:Drosophila_2:1636183_at:120:133; Interrogation_Position=339; Antisense; ACGCAGATTCGGTGGTCGCCGGTTC
>probe:Drosophila_2:1636183_at:564:79; Interrogation_Position=372; Antisense; AGGTGTCCGTGAAGTCGTGATCCGT
>probe:Drosophila_2:1636183_at:151:219; Interrogation_Position=383; Antisense; AAGTCGTGATCCGTGAGCGCGGATT
>probe:Drosophila_2:1636183_at:247:323; Interrogation_Position=399; Antisense; GCGCGGATTGGAGCGCCTCCTTTAA
>probe:Drosophila_2:1636183_at:556:539; Interrogation_Position=41; Antisense; GGTTAGTGGCCCTCATTGCTGCTGT
>probe:Drosophila_2:1636183_at:662:7; Interrogation_Position=55; Antisense; ATTGCTGCTGTCTTTGCTCTTGATG
>probe:Drosophila_2:1636183_at:7:499; Interrogation_Position=64; Antisense; GTCTTTGCTCTTGATGATCCCACAT
>probe:Drosophila_2:1636183_at:240:721; Interrogation_Position=74; Antisense; TTGATGATCCCACATCGCCGACATC

Paste this into a BLAST search page for me
TGTTCCAAACTAACTCTTTTCCTGGTACGGCATCCACTACCACAGAAAGGCTACCACAGAAAGGACTCGCAGACGGCGCAGGCGCAGGATAATCCGGATCGATAATCCGGATCCGCAGGTTCAGGGTCGTGGATTCGGTAGACGCAGATTACGCAGATTCGGTGGTCGCCGGTTCAGGTGTCCGTGAAGTCGTGATCCGTAAGTCGTGATCCGTGAGCGCGGATTGCGCGGATTGGAGCGCCTCCTTTAAGGTTAGTGGCCCTCATTGCTGCTGTATTGCTGCTGTCTTTGCTCTTGATGGTCTTTGCTCTTGATGATCCCACATTTGATGATCCCACATCGCCGACATC

Full Affymetrix probeset data:

Annotations for 1636183_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720