FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636184_at:

>probe:Drosophila_2:1636184_at:334:621; Interrogation_Position=108; Antisense; TGCTGTCTGGTGTTCTCCACCGAGG
>probe:Drosophila_2:1636184_at:139:121; Interrogation_Position=178; Antisense; AGCTGGTCGAGAAGACGTCGGACAA
>probe:Drosophila_2:1636184_at:570:719; Interrogation_Position=298; Antisense; TTGCCGAGGGCAGCGACAACAAAGA
>probe:Drosophila_2:1636184_at:222:213; Interrogation_Position=319; Antisense; AAGAGGACAAGGAGACCGCCACCAA
>probe:Drosophila_2:1636184_at:651:159; Interrogation_Position=346; Antisense; ACAAGGACACCATCGTGAAGCCCAA
>probe:Drosophila_2:1636184_at:52:379; Interrogation_Position=362; Antisense; GAAGCCCAACAAGGATGACGCCCGT
>probe:Drosophila_2:1636184_at:547:435; Interrogation_Position=445; Antisense; GAGGTCGTCGTAGTGCACGCAAATC
>probe:Drosophila_2:1636184_at:269:135; Interrogation_Position=461; Antisense; ACGCAAATCCGTGCGCCGTGGCGGA
>probe:Drosophila_2:1636184_at:302:501; Interrogation_Position=538; Antisense; GTCGCACCTCCGTGAAGAGGCGTTC
>probe:Drosophila_2:1636184_at:217:357; Interrogation_Position=571; Antisense; GCAACAAGGCCTAAGAAGTTCCCCT
>probe:Drosophila_2:1636184_at:720:371; Interrogation_Position=585; Antisense; GAAGTTCCCCTCACAGATATAAGAC
>probe:Drosophila_2:1636184_at:321:21; Interrogation_Position=601; Antisense; ATATAAGACTAACTGCCCGATCCAC
>probe:Drosophila_2:1636184_at:188:629; Interrogation_Position=621; Antisense; TCCACCGATTCGATACACACACAAA
>probe:Drosophila_2:1636184_at:326:163; Interrogation_Position=75; Antisense; AAATATACACTGATCTTTGCCCTGG

Paste this into a BLAST search page for me
TGCTGTCTGGTGTTCTCCACCGAGGAGCTGGTCGAGAAGACGTCGGACAATTGCCGAGGGCAGCGACAACAAAGAAAGAGGACAAGGAGACCGCCACCAAACAAGGACACCATCGTGAAGCCCAAGAAGCCCAACAAGGATGACGCCCGTGAGGTCGTCGTAGTGCACGCAAATCACGCAAATCCGTGCGCCGTGGCGGAGTCGCACCTCCGTGAAGAGGCGTTCGCAACAAGGCCTAAGAAGTTCCCCTGAAGTTCCCCTCACAGATATAAGACATATAAGACTAACTGCCCGATCCACTCCACCGATTCGATACACACACAAAAAATATACACTGATCTTTGCCCTGG

Full Affymetrix probeset data:

Annotations for 1636184_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720