FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636185_at:

>probe:Drosophila_2:1636185_at:90:115; Interrogation_Position=131; Antisense; AGCAGCTCAATTCGCCCGATAATAA
>probe:Drosophila_2:1636185_at:722:19; Interrogation_Position=160; Antisense; ATTTGGGCAACCACGCACAATGCGA
>probe:Drosophila_2:1636185_at:483:135; Interrogation_Position=172; Antisense; ACGCACAATGCGAATATCAGCAGAA
>probe:Drosophila_2:1636185_at:613:185; Interrogation_Position=196; Antisense; AACAACGCAATGTTGCAGCTGCAGC
>probe:Drosophila_2:1636185_at:138:301; Interrogation_Position=238; Antisense; CCCTGGATAACCGATTGCAACAAGC
>probe:Drosophila_2:1636185_at:689:659; Interrogation_Position=245; Antisense; TAACCGATTGCAACAAGCAGCACCA
>probe:Drosophila_2:1636185_at:427:111; Interrogation_Position=308; Antisense; AGCAATTGACGCAACAGCCGCAGCA
>probe:Drosophila_2:1636185_at:709:357; Interrogation_Position=342; Antisense; GCAAACGCAGTACATGCAACACAAT
>probe:Drosophila_2:1636185_at:91:115; Interrogation_Position=395; Antisense; AGCAGCATCTAGTGCCCGCAACAAC
>probe:Drosophila_2:1636185_at:306:235; Interrogation_Position=425; Antisense; AATCCAACAGCCACTTCTACCAGTG
>probe:Drosophila_2:1636185_at:280:123; Interrogation_Position=578; Antisense; AGCGACAGGATTATGCATCCCTTCA
>probe:Drosophila_2:1636185_at:172:347; Interrogation_Position=592; Antisense; GCATCCCTTCAAATGGGCAGACAAG
>probe:Drosophila_2:1636185_at:3:169; Interrogation_Position=602; Antisense; AAATGGGCAGACAAGTGAGTGGACT
>probe:Drosophila_2:1636185_at:716:517; Interrogation_Position=620; Antisense; GTGGACTAGTTAAGTGCGTACGATA

Paste this into a BLAST search page for me
AGCAGCTCAATTCGCCCGATAATAAATTTGGGCAACCACGCACAATGCGAACGCACAATGCGAATATCAGCAGAAAACAACGCAATGTTGCAGCTGCAGCCCCTGGATAACCGATTGCAACAAGCTAACCGATTGCAACAAGCAGCACCAAGCAATTGACGCAACAGCCGCAGCAGCAAACGCAGTACATGCAACACAATAGCAGCATCTAGTGCCCGCAACAACAATCCAACAGCCACTTCTACCAGTGAGCGACAGGATTATGCATCCCTTCAGCATCCCTTCAAATGGGCAGACAAGAAATGGGCAGACAAGTGAGTGGACTGTGGACTAGTTAAGTGCGTACGATA

Full Affymetrix probeset data:

Annotations for 1636185_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720