FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636187_at:

>probe:Drosophila_2:1636187_at:656:665; Interrogation_Position=125; Antisense; TACTATACCCCGCATTATCGTGTAC
>probe:Drosophila_2:1636187_at:281:555; Interrogation_Position=145; Antisense; TGTACCGTACCGCAAGTGCTCATTA
>probe:Drosophila_2:1636187_at:82:621; Interrogation_Position=161; Antisense; TGCTCATTACGAATGCACGGCGAGA
>probe:Drosophila_2:1636187_at:416:601; Interrogation_Position=216; Antisense; TGTTCGCGTTTTTTCGAGGGTCCAT
>probe:Drosophila_2:1636187_at:426:637; Interrogation_Position=229; Antisense; TCGAGGGTCCATTCTCTAGTTGAAA
>probe:Drosophila_2:1636187_at:660:333; Interrogation_Position=284; Antisense; GAAACTTTTCCGACTTCGAGTACTG
>probe:Drosophila_2:1636187_at:87:431; Interrogation_Position=301; Antisense; GAGTACTGTCGCCTTAAATCTGTGA
>probe:Drosophila_2:1636187_at:663:667; Interrogation_Position=340; Antisense; TACATTTCCCTTAAAGTCCATCTCT
>probe:Drosophila_2:1636187_at:289:241; Interrogation_Position=394; Antisense; AATACGGCCATTTATAAGCGCTTGA
>probe:Drosophila_2:1636187_at:159:131; Interrogation_Position=482; Antisense; ACTCGAATCCCGTTACTAAGTTCAT
>probe:Drosophila_2:1636187_at:607:655; Interrogation_Position=498; Antisense; TAAGTTCATCTTCGGTGTTTTCAAA
>probe:Drosophila_2:1636187_at:563:103; Interrogation_Position=522; Antisense; AGACGCCACCAATATGAACCATTCC
>probe:Drosophila_2:1636187_at:25:627; Interrogation_Position=547; Antisense; TGCCCCTACGACCATGACATAATTA
>probe:Drosophila_2:1636187_at:503:381; Interrogation_Position=654; Antisense; GAACTGGTTCGCCTATGACATTAAC

Paste this into a BLAST search page for me
TACTATACCCCGCATTATCGTGTACTGTACCGTACCGCAAGTGCTCATTATGCTCATTACGAATGCACGGCGAGATGTTCGCGTTTTTTCGAGGGTCCATTCGAGGGTCCATTCTCTAGTTGAAAGAAACTTTTCCGACTTCGAGTACTGGAGTACTGTCGCCTTAAATCTGTGATACATTTCCCTTAAAGTCCATCTCTAATACGGCCATTTATAAGCGCTTGAACTCGAATCCCGTTACTAAGTTCATTAAGTTCATCTTCGGTGTTTTCAAAAGACGCCACCAATATGAACCATTCCTGCCCCTACGACCATGACATAATTAGAACTGGTTCGCCTATGACATTAAC

Full Affymetrix probeset data:

Annotations for 1636187_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720