Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636189_at:

>probe:Drosophila_2:1636189_at:531:487; Interrogation_Position=2403; Antisense; GTAGCCAGCCCAACTATCATTATAA
>probe:Drosophila_2:1636189_at:639:197; Interrogation_Position=2444; Antisense; AACGTAATTCACGAATGCCCTGGCC
>probe:Drosophila_2:1636189_at:712:49; Interrogation_Position=2458; Antisense; ATGCCCTGGCCAACTTCATTTATAG
>probe:Drosophila_2:1636189_at:198:703; Interrogation_Position=2477; Antisense; TTATAGCCCAGAAAGTATCCTCCTC
>probe:Drosophila_2:1636189_at:315:631; Interrogation_Position=2497; Antisense; TCCTCTCCCATCATCTTTTAAAATT
>probe:Drosophila_2:1636189_at:336:599; Interrogation_Position=2521; Antisense; TGTAGTTCCCGTTCAAATTGATTTG
>probe:Drosophila_2:1636189_at:290:257; Interrogation_Position=2578; Antisense; CCTTCCCCTTCATATCGAAAATACT
>probe:Drosophila_2:1636189_at:568:21; Interrogation_Position=2612; Antisense; ATATTCATCGTCAGTGTTGGGCCTC
>probe:Drosophila_2:1636189_at:585:599; Interrogation_Position=2626; Antisense; TGTTGGGCCTCCCTCAAAAGTAATT
>probe:Drosophila_2:1636189_at:628:589; Interrogation_Position=2667; Antisense; TGGTTTTCGTACACGATCCGATCAC
>probe:Drosophila_2:1636189_at:141:295; Interrogation_Position=2680; Antisense; CGATCCGATCACTTAATGCATTTTA
>probe:Drosophila_2:1636189_at:397:109; Interrogation_Position=2732; Antisense; AGCAAACGTGTTTCGAAATGCCTAT
>probe:Drosophila_2:1636189_at:340:167; Interrogation_Position=2747; Antisense; AAATGCCTATATTCACCGAGGTGAC
>probe:Drosophila_2:1636189_at:548:243; Interrogation_Position=2818; Antisense; AATATTGTGCGTTCGTAGTGCGCTA

Paste this into a BLAST search page for me
GTAGCCAGCCCAACTATCATTATAAAACGTAATTCACGAATGCCCTGGCCATGCCCTGGCCAACTTCATTTATAGTTATAGCCCAGAAAGTATCCTCCTCTCCTCTCCCATCATCTTTTAAAATTTGTAGTTCCCGTTCAAATTGATTTGCCTTCCCCTTCATATCGAAAATACTATATTCATCGTCAGTGTTGGGCCTCTGTTGGGCCTCCCTCAAAAGTAATTTGGTTTTCGTACACGATCCGATCACCGATCCGATCACTTAATGCATTTTAAGCAAACGTGTTTCGAAATGCCTATAAATGCCTATATTCACCGAGGTGACAATATTGTGCGTTCGTAGTGCGCTA

Full Affymetrix probeset data:

Annotations for 1636189_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime