FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636190_at:

>probe:Drosophila_2:1636190_at:206:325; Interrogation_Position=125; Antisense; GCGAAGTATGGTCGTTGCGCTACAC
>probe:Drosophila_2:1636190_at:155:135; Interrogation_Position=148; Antisense; ACGCCCGGAATTCTGAGTGCTTTGG
>probe:Drosophila_2:1636190_at:594:195; Interrogation_Position=180; Antisense; AACGGGCGCCTACATAAATAATCAT
>probe:Drosophila_2:1636190_at:576:399; Interrogation_Position=230; Antisense; GACATGGTCGATTGTCCACTTACCT
>probe:Drosophila_2:1636190_at:723:21; Interrogation_Position=277; Antisense; ATATTTACCATGCTGGCGCACAAGT
>probe:Drosophila_2:1636190_at:276:161; Interrogation_Position=296; Antisense; ACAAGTTCTTTATTCAGCGGCCCAT
>probe:Drosophila_2:1636190_at:247:47; Interrogation_Position=319; Antisense; ATCCTACTAAATCCGCTGGGCGAGT
>probe:Drosophila_2:1636190_at:222:433; Interrogation_Position=340; Antisense; GAGTGCCCGGTGTGCATCCAGATGC
>probe:Drosophila_2:1636190_at:505:85; Interrogation_Position=367; Antisense; AGTGCTGCCTTTCAGACAAGTCTGG
>probe:Drosophila_2:1636190_at:699:569; Interrogation_Position=391; Antisense; GGCATCGTATATCCCACAATTCTGG
>probe:Drosophila_2:1636190_at:478:651; Interrogation_Position=451; Antisense; TACACGTACCGTATTCCCTCGATTA
>probe:Drosophila_2:1636190_at:31:729; Interrogation_Position=527; Antisense; TTGTCCCAGCCTTAGGAACCTTAAT
>probe:Drosophila_2:1636190_at:39:659; Interrogation_Position=569; Antisense; TAACCATGTTCCTTACTGGCCAGGA
>probe:Drosophila_2:1636190_at:68:437; Interrogation_Position=649; Antisense; GAGGAGGAACACTTGCCACAGCGAA

Paste this into a BLAST search page for me
GCGAAGTATGGTCGTTGCGCTACACACGCCCGGAATTCTGAGTGCTTTGGAACGGGCGCCTACATAAATAATCATGACATGGTCGATTGTCCACTTACCTATATTTACCATGCTGGCGCACAAGTACAAGTTCTTTATTCAGCGGCCCATATCCTACTAAATCCGCTGGGCGAGTGAGTGCCCGGTGTGCATCCAGATGCAGTGCTGCCTTTCAGACAAGTCTGGGGCATCGTATATCCCACAATTCTGGTACACGTACCGTATTCCCTCGATTATTGTCCCAGCCTTAGGAACCTTAATTAACCATGTTCCTTACTGGCCAGGAGAGGAGGAACACTTGCCACAGCGAA

Full Affymetrix probeset data:

Annotations for 1636190_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720