Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636192_at:

>probe:Drosophila_2:1636192_at:237:395; Interrogation_Position=1045; Antisense; GAAATCCCCAGAGAAGAATCCACTG
>probe:Drosophila_2:1636192_at:545:485; Interrogation_Position=1139; Antisense; GTAAATACTAAGCACCAGCCGAAGG
>probe:Drosophila_2:1636192_at:559:707; Interrogation_Position=1170; Antisense; TTAAGAGAAAGTCGCCCAAGGAGAA
>probe:Drosophila_2:1636192_at:562:577; Interrogation_Position=721; Antisense; GGCCCTGATGAAGCGTGCTACTAAG
>probe:Drosophila_2:1636192_at:249:509; Interrogation_Position=735; Antisense; GTGCTACTAAGAAGGTCCTCACCAA
>probe:Drosophila_2:1636192_at:719:23; Interrogation_Position=757; Antisense; CAAGGGTAACTTCACCTCGTCCGTG
>probe:Drosophila_2:1636192_at:462:637; Interrogation_Position=773; Antisense; TCGTCCGTGGTCATTACCAATCTGC
>probe:Drosophila_2:1636192_at:588:171; Interrogation_Position=799; Antisense; AAAGACCAGTTCGTTGCCCCAGGTG
>probe:Drosophila_2:1636192_at:408:117; Interrogation_Position=828; Antisense; AGCTGTTCCACGACCAGGCAGTGGA
>probe:Drosophila_2:1636192_at:526:517; Interrogation_Position=848; Antisense; GTGGACATTCAAATACGACCGGGCA
>probe:Drosophila_2:1636192_at:639:287; Interrogation_Position=884; Antisense; CGGGACTACAGCACGGCGACCGTAA
>probe:Drosophila_2:1636192_at:248:225; Interrogation_Position=944; Antisense; AAGGAGAAGCTCAGCCTGGCTGGCA
>probe:Drosophila_2:1636192_at:396:355; Interrogation_Position=966; Antisense; GCACGCCACTTATATTGCGCTTCAA
>probe:Drosophila_2:1636192_at:162:9; Interrogation_Position=979; Antisense; ATTGCGCTTCAACACTCAGAACAAG

Paste this into a BLAST search page for me
GAAATCCCCAGAGAAGAATCCACTGGTAAATACTAAGCACCAGCCGAAGGTTAAGAGAAAGTCGCCCAAGGAGAAGGCCCTGATGAAGCGTGCTACTAAGGTGCTACTAAGAAGGTCCTCACCAACAAGGGTAACTTCACCTCGTCCGTGTCGTCCGTGGTCATTACCAATCTGCAAAGACCAGTTCGTTGCCCCAGGTGAGCTGTTCCACGACCAGGCAGTGGAGTGGACATTCAAATACGACCGGGCACGGGACTACAGCACGGCGACCGTAAAAGGAGAAGCTCAGCCTGGCTGGCAGCACGCCACTTATATTGCGCTTCAAATTGCGCTTCAACACTCAGAACAAG

Full Affymetrix probeset data:

Annotations for 1636192_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime