FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636193_at:

>probe:Drosophila_2:1636193_at:563:465; Interrogation_Position=1636; Antisense; GATTGGTTACATCTCTACACGACCG
>probe:Drosophila_2:1636193_at:576:663; Interrogation_Position=1670; Antisense; TACACGGTGGTTTTCGACAACTCCG
>probe:Drosophila_2:1636193_at:463:211; Interrogation_Position=1712; Antisense; AAGAAGCTCCGCTACTGGGTGGACC
>probe:Drosophila_2:1636193_at:181:141; Interrogation_Position=1725; Antisense; ACTGGGTGGACCTCATCTCTGAGGA
>probe:Drosophila_2:1636193_at:15:77; Interrogation_Position=1752; Antisense; AGGAGGGCATATCCGAGCTGACCAC
>probe:Drosophila_2:1636193_at:150:441; Interrogation_Position=1780; Antisense; GATGGACAACACTCAGATTGCGAAT
>probe:Drosophila_2:1636193_at:60:613; Interrogation_Position=1811; Antisense; TGAACGGGAGCTATTCACCGCGCGA
>probe:Drosophila_2:1636193_at:335:191; Interrogation_Position=1895; Antisense; AACTAACCTCGGTGCAATAGTCACA
>probe:Drosophila_2:1636193_at:146:173; Interrogation_Position=1919; Antisense; AAAGCATTTTGCCAGATCTCCGCTG
>probe:Drosophila_2:1636193_at:693:287; Interrogation_Position=1979; Antisense; CTGGCGCATCTGCAATCGAACTATG
>probe:Drosophila_2:1636193_at:20:373; Interrogation_Position=2034; Antisense; GAAGTATGACTCACACCTACATTTA
>probe:Drosophila_2:1636193_at:269:701; Interrogation_Position=2076; Antisense; TTTTATTACATAGCCGCACTAGCCG
>probe:Drosophila_2:1636193_at:304:355; Interrogation_Position=2091; Antisense; GCACTAGCCGCACTGTTTAGTTAAC
>probe:Drosophila_2:1636193_at:350:231; Interrogation_Position=2181; Antisense; AATGTATATAGCATCTGATCCCCAA

Paste this into a BLAST search page for me
GATTGGTTACATCTCTACACGACCGTACACGGTGGTTTTCGACAACTCCGAAGAAGCTCCGCTACTGGGTGGACCACTGGGTGGACCTCATCTCTGAGGAAGGAGGGCATATCCGAGCTGACCACGATGGACAACACTCAGATTGCGAATTGAACGGGAGCTATTCACCGCGCGAAACTAACCTCGGTGCAATAGTCACAAAAGCATTTTGCCAGATCTCCGCTGCTGGCGCATCTGCAATCGAACTATGGAAGTATGACTCACACCTACATTTATTTTATTACATAGCCGCACTAGCCGGCACTAGCCGCACTGTTTAGTTAACAATGTATATAGCATCTGATCCCCAA

Full Affymetrix probeset data:

Annotations for 1636193_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720