Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636196_s_at:

>probe:Drosophila_2:1636196_s_at:55:181; Interrogation_Position=121; Antisense; AAAAAGTTCATCTTCCTGACGTGGA
>probe:Drosophila_2:1636196_s_at:94:217; Interrogation_Position=124; Antisense; AAGTTCATCTTCCTGACGTGGATCG
>probe:Drosophila_2:1636196_s_at:707:35; Interrogation_Position=130; Antisense; ATCTTCCTGACGTGGATCGGGCAGG
>probe:Drosophila_2:1636196_s_at:316:99; Interrogation_Position=179; Antisense; AGATGTCCACGGACAAGGCGCTGAT
>probe:Drosophila_2:1636196_s_at:604:227; Interrogation_Position=193; Antisense; AAGGCGCTGATCAAGGATGTCCTCA
>probe:Drosophila_2:1636196_s_at:597:441; Interrogation_Position=208; Antisense; GATGTCCTCAACAATTTTGCCGTGG
>probe:Drosophila_2:1636196_s_at:518:185; Interrogation_Position=217; Antisense; AACAATTTTGCCGTGGAACTTCAGG
>probe:Drosophila_2:1636196_s_at:518:701; Interrogation_Position=222; Antisense; TTTTGCCGTGGAACTTCAGGCGGGA
>probe:Drosophila_2:1636196_s_at:459:585; Interrogation_Position=260; Antisense; TGGACATTGAGCTCTTCCGTGAAGC
>probe:Drosophila_2:1636196_s_at:256:151; Interrogation_Position=263; Antisense; ACATTGAGCTCTTCCGTGAAGCACT
>probe:Drosophila_2:1636196_s_at:402:417; Interrogation_Position=268; Antisense; GAGCTCTTCCGTGAAGCACTGAACC
>probe:Drosophila_2:1636196_s_at:181:145; Interrogation_Position=312; Antisense; ACTGCTTACCAAACTGCTCCTTTCT
>probe:Drosophila_2:1636196_s_at:181:675; Interrogation_Position=318; Antisense; TACCAAACTGCTCCTTTCTCTTTAA
>probe:Drosophila_2:1636196_s_at:353:265; Interrogation_Position=94; Antisense; CAGATGGGTGACGAGATGTCCAAGC

Paste this into a BLAST search page for me
AAAAAGTTCATCTTCCTGACGTGGAAAGTTCATCTTCCTGACGTGGATCGATCTTCCTGACGTGGATCGGGCAGGAGATGTCCACGGACAAGGCGCTGATAAGGCGCTGATCAAGGATGTCCTCAGATGTCCTCAACAATTTTGCCGTGGAACAATTTTGCCGTGGAACTTCAGGTTTTGCCGTGGAACTTCAGGCGGGATGGACATTGAGCTCTTCCGTGAAGCACATTGAGCTCTTCCGTGAAGCACTGAGCTCTTCCGTGAAGCACTGAACCACTGCTTACCAAACTGCTCCTTTCTTACCAAACTGCTCCTTTCTCTTTAACAGATGGGTGACGAGATGTCCAAGC

Full Affymetrix probeset data:

Annotations for 1636196_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime