FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636197_at:

>probe:Drosophila_2:1636197_at:500:21; Interrogation_Position=1023; Antisense; ATATTATGTGTCTCCCCAGGCTGGA
>probe:Drosophila_2:1636197_at:239:1; Interrogation_Position=1040; Antisense; AGGCTGGAACCGCAATCTTCTGGTA
>probe:Drosophila_2:1636197_at:344:65; Interrogation_Position=1079; Antisense; ATGGAAATGGTGATCCCCGCACAAG
>probe:Drosophila_2:1636197_at:450:315; Interrogation_Position=1111; Antisense; GCCTGTCCAGTGATTGTGGGTTCCA
>probe:Drosophila_2:1636197_at:300:173; Interrogation_Position=1164; Antisense; AAAGCGGCAGATCTTCATCAGACCC
>probe:Drosophila_2:1636197_at:427:101; Interrogation_Position=641; Antisense; AGAGCTCCACTAGACTGCACTGTTT
>probe:Drosophila_2:1636197_at:217:713; Interrogation_Position=664; Antisense; TTCTATAACTTTACCACGACTCCAT
>probe:Drosophila_2:1636197_at:671:717; Interrogation_Position=692; Antisense; TTCGCTTAGCTCCACTCAAAACGGA
>probe:Drosophila_2:1636197_at:494:517; Interrogation_Position=739; Antisense; GTGGTGCTTTATCACGAAGTGCTCT
>probe:Drosophila_2:1636197_at:92:137; Interrogation_Position=752; Antisense; ACGAAGTGCTCTCTGCTCGAGAAAT
>probe:Drosophila_2:1636197_at:288:101; Interrogation_Position=911; Antisense; AGAGAATTACTAGGCGCATCATGGA
>probe:Drosophila_2:1636197_at:93:583; Interrogation_Position=942; Antisense; TGGCTTTGACCTGGCTGATTCTGAA
>probe:Drosophila_2:1636197_at:180:543; Interrogation_Position=967; Antisense; GGATTTCAGCTGACTGATGTCGAAC
>probe:Drosophila_2:1636197_at:211:519; Interrogation_Position=995; Antisense; GTGGAGCCACCGTCTTTGGAGACGT

Paste this into a BLAST search page for me
ATATTATGTGTCTCCCCAGGCTGGAAGGCTGGAACCGCAATCTTCTGGTAATGGAAATGGTGATCCCCGCACAAGGCCTGTCCAGTGATTGTGGGTTCCAAAAGCGGCAGATCTTCATCAGACCCAGAGCTCCACTAGACTGCACTGTTTTTCTATAACTTTACCACGACTCCATTTCGCTTAGCTCCACTCAAAACGGAGTGGTGCTTTATCACGAAGTGCTCTACGAAGTGCTCTCTGCTCGAGAAATAGAGAATTACTAGGCGCATCATGGATGGCTTTGACCTGGCTGATTCTGAAGGATTTCAGCTGACTGATGTCGAACGTGGAGCCACCGTCTTTGGAGACGT

Full Affymetrix probeset data:

Annotations for 1636197_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720