FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636198_at:

>probe:Drosophila_2:1636198_at:432:467; Interrogation_Position=257; Antisense; GTTGTCGTACAACTACACCAGTGGC
>probe:Drosophila_2:1636198_at:280:403; Interrogation_Position=285; Antisense; GACTTCCTCTCGTACATGGAGTATC
>probe:Drosophila_2:1636198_at:29:589; Interrogation_Position=301; Antisense; TGGAGTATCCTGTTTTGCTGCTGCA
>probe:Drosophila_2:1636198_at:131:77; Interrogation_Position=325; Antisense; AGGAGTACGCCCTGATTTACTACGC
>probe:Drosophila_2:1636198_at:552:25; Interrogation_Position=408; Antisense; ATAGTGGCCACTCTCATATACATGA
>probe:Drosophila_2:1636198_at:423:55; Interrogation_Position=429; Antisense; ATGAAGCTCTTTCCCATTATCATCC
>probe:Drosophila_2:1636198_at:648:697; Interrogation_Position=445; Antisense; TTATCATCCTTAAGTTCCTGGTGCC
>probe:Drosophila_2:1636198_at:220:119; Interrogation_Position=508; Antisense; AGCTGCTGGCTATTCTGAGGACCAA
>probe:Drosophila_2:1636198_at:455:223; Interrogation_Position=531; Antisense; AAGGATGCCAGTTCCGTCAGTAGAA
>probe:Drosophila_2:1636198_at:578:493; Interrogation_Position=546; Antisense; GTCAGTAGAACCACATGGGCGCTCT
>probe:Drosophila_2:1636198_at:548:53; Interrogation_Position=585; Antisense; ATGACTCGAATCTACACGGTGTTCT
>probe:Drosophila_2:1636198_at:407:265; Interrogation_Position=612; Antisense; CAGTCCCACGATTGGATGTTGCTAT
>probe:Drosophila_2:1636198_at:673:647; Interrogation_Position=636; Antisense; TCAAACTTCCTGATTTCGACGTTCC
>probe:Drosophila_2:1636198_at:212:677; Interrogation_Position=749; Antisense; TAGACAAACACTGCGCTGGCTGGAA

Paste this into a BLAST search page for me
GTTGTCGTACAACTACACCAGTGGCGACTTCCTCTCGTACATGGAGTATCTGGAGTATCCTGTTTTGCTGCTGCAAGGAGTACGCCCTGATTTACTACGCATAGTGGCCACTCTCATATACATGAATGAAGCTCTTTCCCATTATCATCCTTATCATCCTTAAGTTCCTGGTGCCAGCTGCTGGCTATTCTGAGGACCAAAAGGATGCCAGTTCCGTCAGTAGAAGTCAGTAGAACCACATGGGCGCTCTATGACTCGAATCTACACGGTGTTCTCAGTCCCACGATTGGATGTTGCTATTCAAACTTCCTGATTTCGACGTTCCTAGACAAACACTGCGCTGGCTGGAA

Full Affymetrix probeset data:

Annotations for 1636198_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720