Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636199_at:

>probe:Drosophila_2:1636199_at:710:479; Interrogation_Position=2906; Antisense; GTCTTGAGAGCACTAACAAATTTTC
>probe:Drosophila_2:1636199_at:524:167; Interrogation_Position=2956; Antisense; AAATGTGTAGTTCAGCTCGTGTAGC
>probe:Drosophila_2:1636199_at:377:473; Interrogation_Position=2965; Antisense; GTTCAGCTCGTGTAGCACGATTGAA
>probe:Drosophila_2:1636199_at:324:675; Interrogation_Position=3016; Antisense; TTTGGTTTCCTTAAGCTATAAATTG
>probe:Drosophila_2:1636199_at:492:601; Interrogation_Position=3047; Antisense; TGTATGTATACCTTATGATATCTGT
>probe:Drosophila_2:1636199_at:357:613; Interrogation_Position=3073; Antisense; TGAATACCCTGATTTTTTAAGTCTT
>probe:Drosophila_2:1636199_at:104:223; Interrogation_Position=3159; Antisense; AAGGGTGTTACTGCGTTCTATTCAA
>probe:Drosophila_2:1636199_at:645:651; Interrogation_Position=3180; Antisense; TCAAATAAATATCCCAAGCAAGCCA
>probe:Drosophila_2:1636199_at:298:15; Interrogation_Position=3251; Antisense; ATTTTAGACGCAGCCAAGCCACAAA
>probe:Drosophila_2:1636199_at:353:351; Interrogation_Position=3260; Antisense; GCAGCCAAGCCACAAAAACCCAATG
>probe:Drosophila_2:1636199_at:161:225; Interrogation_Position=3323; Antisense; AAGGAGTTGCTCCAACGTTGCGTAT
>probe:Drosophila_2:1636199_at:214:309; Interrogation_Position=3334; Antisense; CCAACGTTGCGTATACTTGATTTGC
>probe:Drosophila_2:1636199_at:652:459; Interrogation_Position=3352; Antisense; GATTTGCAACACGACATTTTAAGAA
>probe:Drosophila_2:1636199_at:238:515; Interrogation_Position=3427; Antisense; GTGTTTGCAATAATTCATAAGCCAT

Paste this into a BLAST search page for me
GTCTTGAGAGCACTAACAAATTTTCAAATGTGTAGTTCAGCTCGTGTAGCGTTCAGCTCGTGTAGCACGATTGAATTTGGTTTCCTTAAGCTATAAATTGTGTATGTATACCTTATGATATCTGTTGAATACCCTGATTTTTTAAGTCTTAAGGGTGTTACTGCGTTCTATTCAATCAAATAAATATCCCAAGCAAGCCAATTTTAGACGCAGCCAAGCCACAAAGCAGCCAAGCCACAAAAACCCAATGAAGGAGTTGCTCCAACGTTGCGTATCCAACGTTGCGTATACTTGATTTGCGATTTGCAACACGACATTTTAAGAAGTGTTTGCAATAATTCATAAGCCAT

Full Affymetrix probeset data:

Annotations for 1636199_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime