FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636201_at:

>probe:Drosophila_2:1636201_at:175:129; Interrogation_Position=190; Antisense; ACGTTGGTCTACAGTTATGCCGGAG
>probe:Drosophila_2:1636201_at:542:45; Interrogation_Position=206; Antisense; ATGCCGGAGGATTTTCTTCCTTGGA
>probe:Drosophila_2:1636201_at:68:201; Interrogation_Position=273; Antisense; AACCTGTGTGAAATTTCGCCGAACG
>probe:Drosophila_2:1636201_at:269:527; Interrogation_Position=369; Antisense; GGGAAGAGCAGACCAGACCCTCAAT
>probe:Drosophila_2:1636201_at:613:411; Interrogation_Position=384; Antisense; GACCCTCAATCTAGGCAGTGGTTGT
>probe:Drosophila_2:1636201_at:306:53; Interrogation_Position=431; Antisense; ATGAACTTCTTCACGCCTTAGGCTT
>probe:Drosophila_2:1636201_at:696:679; Interrogation_Position=449; Antisense; TAGGCTTCTTTCACACACACAGCGA
>probe:Drosophila_2:1636201_at:118:455; Interrogation_Position=508; Antisense; GATAACATCAGATCCGGTCATGAAC
>probe:Drosophila_2:1636201_at:490:71; Interrogation_Position=544; Antisense; AGGCTTCGTGCCAATGGAGTGACAA
>probe:Drosophila_2:1636201_at:608:705; Interrogation_Position=570; Antisense; TTATGGATTTGGCTACGACTACGAC
>probe:Drosophila_2:1636201_at:618:399; Interrogation_Position=592; Antisense; GACAGCATTATGCACTATGGTCCAT
>probe:Drosophila_2:1636201_at:11:65; Interrogation_Position=608; Antisense; ATGGTCCATTTGCTTTCTCCAAGAA
>probe:Drosophila_2:1636201_at:195:557; Interrogation_Position=634; Antisense; GGACAGTCGACAATTGTTCCTTTGA
>probe:Drosophila_2:1636201_at:185:471; Interrogation_Position=649; Antisense; GTTCCTTTGAAATCCCATGCGAAAA

Paste this into a BLAST search page for me
ACGTTGGTCTACAGTTATGCCGGAGATGCCGGAGGATTTTCTTCCTTGGAAACCTGTGTGAAATTTCGCCGAACGGGGAAGAGCAGACCAGACCCTCAATGACCCTCAATCTAGGCAGTGGTTGTATGAACTTCTTCACGCCTTAGGCTTTAGGCTTCTTTCACACACACAGCGAGATAACATCAGATCCGGTCATGAACAGGCTTCGTGCCAATGGAGTGACAATTATGGATTTGGCTACGACTACGACGACAGCATTATGCACTATGGTCCATATGGTCCATTTGCTTTCTCCAAGAAGGACAGTCGACAATTGTTCCTTTGAGTTCCTTTGAAATCCCATGCGAAAA

Full Affymetrix probeset data:

Annotations for 1636201_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720