Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636202_s_at:

>probe:Drosophila_2:1636202_s_at:32:225; Interrogation_Position=1002; Antisense; AAGGATACCGCCGATACCTTCGTGT
>probe:Drosophila_2:1636202_s_at:634:129; Interrogation_Position=1017; Antisense; ACCTTCGTGTATCCCGTACTTAATG
>probe:Drosophila_2:1636202_s_at:661:371; Interrogation_Position=1044; Antisense; GAAGACTAAAGATCCTACCACCAAA
>probe:Drosophila_2:1636202_s_at:85:43; Interrogation_Position=1078; Antisense; AAAGGCTATTGGATTGACGACGGAA
>probe:Drosophila_2:1636202_s_at:470:451; Interrogation_Position=1124; Antisense; GATCAAATGCCTTCGAAGATGCGTG
>probe:Drosophila_2:1636202_s_at:117:23; Interrogation_Position=622; Antisense; ATATCATCGACCACGTGCTGAGCGA
>probe:Drosophila_2:1636202_s_at:430:595; Interrogation_Position=663; Antisense; TGTGTGGGACGCACTGGCTCCAAGA
>probe:Drosophila_2:1636202_s_at:610:251; Interrogation_Position=683; Antisense; CAAGACCATCTATGCCAGCACTGTG
>probe:Drosophila_2:1636202_s_at:600:391; Interrogation_Position=764; Antisense; GAAACCGCGAATCATCTACACCGAG
>probe:Drosophila_2:1636202_s_at:477:109; Interrogation_Position=787; Antisense; AGAAGACGCATCTGGACCTCATGGG
>probe:Drosophila_2:1636202_s_at:535:299; Interrogation_Position=852; Antisense; CGCGCCGAGATCACCTGGTTGAATA
>probe:Drosophila_2:1636202_s_at:360:225; Interrogation_Position=898; Antisense; AAGGACATCGCCACAGGGTGCTGGC
>probe:Drosophila_2:1636202_s_at:310:197; Interrogation_Position=924; Antisense; AACGGCGATCTTCTGATCTCCGAGA
>probe:Drosophila_2:1636202_s_at:443:671; Interrogation_Position=982; Antisense; TAGCCCGCAACGTCGTCGGAAAGGA

Paste this into a BLAST search page for me
AAGGATACCGCCGATACCTTCGTGTACCTTCGTGTATCCCGTACTTAATGGAAGACTAAAGATCCTACCACCAAAAAAGGCTATTGGATTGACGACGGAAGATCAAATGCCTTCGAAGATGCGTGATATCATCGACCACGTGCTGAGCGATGTGTGGGACGCACTGGCTCCAAGACAAGACCATCTATGCCAGCACTGTGGAAACCGCGAATCATCTACACCGAGAGAAGACGCATCTGGACCTCATGGGCGCGCCGAGATCACCTGGTTGAATAAAGGACATCGCCACAGGGTGCTGGCAACGGCGATCTTCTGATCTCCGAGATAGCCCGCAACGTCGTCGGAAAGGA

Full Affymetrix probeset data:

Annotations for 1636202_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime