FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636206_at:

>probe:Drosophila_2:1636206_at:702:477; Interrogation_Position=148; Antisense; GTTTTTATTGTCGTATGTCCATCCA
>probe:Drosophila_2:1636206_at:137:559; Interrogation_Position=265; Antisense; GGAACGGTCGCAAGACGCTAACCAC
>probe:Drosophila_2:1636206_at:511:317; Interrogation_Position=298; Antisense; GCCTGTCCGCGGAGTATGACTTGAA
>probe:Drosophila_2:1636206_at:338:377; Interrogation_Position=320; Antisense; GAAGAAGATAGTCCGCTCCTGCAAG
>probe:Drosophila_2:1636206_at:76:565; Interrogation_Position=347; Antisense; GGAATTCGCATGCAATGGCACTGTA
>probe:Drosophila_2:1636206_at:424:567; Interrogation_Position=363; Antisense; GGCACTGTAATCGAGCACCCAGAGT
>probe:Drosophila_2:1636206_at:457:483; Interrogation_Position=386; Antisense; GTATGGTGAGGTTCTGCAGCTCCAG
>probe:Drosophila_2:1636206_at:327:119; Interrogation_Position=403; Antisense; AGCTCCAGGGCGATCAGCGTGAGAA
>probe:Drosophila_2:1636206_at:453:221; Interrogation_Position=447; Antisense; AAGGTGGGTCTAGCTAAGCCGGATC
>probe:Drosophila_2:1636206_at:130:81; Interrogation_Position=478; Antisense; AGGTGCACGGCTTCTAAGCGGTCGA
>probe:Drosophila_2:1636206_at:521:517; Interrogation_Position=514; Antisense; GTGTGAATCTTCATACCACTCTTTC
>probe:Drosophila_2:1636206_at:642:25; Interrogation_Position=526; Antisense; ATACCACTCTTTCATTCTTAAGCTC
>probe:Drosophila_2:1636206_at:698:709; Interrogation_Position=543; Antisense; TTAAGCTCTGCAACAACACCCAAAA
>probe:Drosophila_2:1636206_at:117:597; Interrogation_Position=698; Antisense; TGTGCGGGCGCTGTCGTAGTATAAT

Paste this into a BLAST search page for me
GTTTTTATTGTCGTATGTCCATCCAGGAACGGTCGCAAGACGCTAACCACGCCTGTCCGCGGAGTATGACTTGAAGAAGAAGATAGTCCGCTCCTGCAAGGGAATTCGCATGCAATGGCACTGTAGGCACTGTAATCGAGCACCCAGAGTGTATGGTGAGGTTCTGCAGCTCCAGAGCTCCAGGGCGATCAGCGTGAGAAAAGGTGGGTCTAGCTAAGCCGGATCAGGTGCACGGCTTCTAAGCGGTCGAGTGTGAATCTTCATACCACTCTTTCATACCACTCTTTCATTCTTAAGCTCTTAAGCTCTGCAACAACACCCAAAATGTGCGGGCGCTGTCGTAGTATAAT

Full Affymetrix probeset data:

Annotations for 1636206_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720