FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636207_at:

>probe:Drosophila_2:1636207_at:264:39; Interrogation_Position=1265; Antisense; ATCTCTATTCGACTGTGCCAGCGGA
>probe:Drosophila_2:1636207_at:275:387; Interrogation_Position=1313; Antisense; GAACAACGTGCTGTACGCCATTGAG
>probe:Drosophila_2:1636207_at:317:609; Interrogation_Position=1334; Antisense; TGAGCGCTCTGAAAGTTGCCATTCC
>probe:Drosophila_2:1636207_at:25:493; Interrogation_Position=1374; Antisense; GTGAAAAAACCCATTCCCATTCGCG
>probe:Drosophila_2:1636207_at:503:551; Interrogation_Position=1436; Antisense; GGAGAGAGCCACGTTCCTCGAGAAG
>probe:Drosophila_2:1636207_at:102:635; Interrogation_Position=1453; Antisense; TCGAGAAGCTGCAACGGGCCGCTGT
>probe:Drosophila_2:1636207_at:450:303; Interrogation_Position=1523; Antisense; CCGCTGCGGGCAGTGCAATTTAGAA
>probe:Drosophila_2:1636207_at:272:365; Interrogation_Position=1545; Antisense; GAATTTGACTCAGTCTCCGAACTGG
>probe:Drosophila_2:1636207_at:73:361; Interrogation_Position=1597; Antisense; GCAATGAACTGAACGCCGACGACGA
>probe:Drosophila_2:1636207_at:326:33; Interrogation_Position=1638; Antisense; ATAATCGCCCTCTTCGAGGATGATA
>probe:Drosophila_2:1636207_at:269:159; Interrogation_Position=1673; Antisense; ACAAAGTCCTGTTTTTCATGCCGGT
>probe:Drosophila_2:1636207_at:568:45; Interrogation_Position=1690; Antisense; ATGCCGGTGGCTCAATCAAACTAGT
>probe:Drosophila_2:1636207_at:545:275; Interrogation_Position=1729; Antisense; CTTTGCATCTGTGTTTTTGTCGTAT
>probe:Drosophila_2:1636207_at:17:619; Interrogation_Position=1808; Antisense; TGCTTAGCGGCAATCCATGTTCATT

Paste this into a BLAST search page for me
ATCTCTATTCGACTGTGCCAGCGGAGAACAACGTGCTGTACGCCATTGAGTGAGCGCTCTGAAAGTTGCCATTCCGTGAAAAAACCCATTCCCATTCGCGGGAGAGAGCCACGTTCCTCGAGAAGTCGAGAAGCTGCAACGGGCCGCTGTCCGCTGCGGGCAGTGCAATTTAGAAGAATTTGACTCAGTCTCCGAACTGGGCAATGAACTGAACGCCGACGACGAATAATCGCCCTCTTCGAGGATGATAACAAAGTCCTGTTTTTCATGCCGGTATGCCGGTGGCTCAATCAAACTAGTCTTTGCATCTGTGTTTTTGTCGTATTGCTTAGCGGCAATCCATGTTCATT

Full Affymetrix probeset data:

Annotations for 1636207_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720