Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636210_at:

>probe:Drosophila_2:1636210_at:280:569; Interrogation_Position=1073; Antisense; GGCTTCCTCCAGTTGCGAAAGCAGT
>probe:Drosophila_2:1636210_at:151:577; Interrogation_Position=1097; Antisense; TGGCGTTTCCTCCAAACAGAGCGAA
>probe:Drosophila_2:1636210_at:717:609; Interrogation_Position=1145; Antisense; TGACCTTAGTATCCGCATTGATCCG
>probe:Drosophila_2:1636210_at:653:287; Interrogation_Position=1179; Antisense; CTGGCCTATCAGCTCTCGGAAGAAA
>probe:Drosophila_2:1636210_at:218:179; Interrogation_Position=1202; Antisense; AAACTTTCAGGTGCTCGACAGTAAA
>probe:Drosophila_2:1636210_at:13:493; Interrogation_Position=1222; Antisense; GTAAACATTCGACGCAGCCGGAGAA
>probe:Drosophila_2:1636210_at:534:333; Interrogation_Position=1250; Antisense; GCTCGGTCACGGCATGGACTTCAAA
>probe:Drosophila_2:1636210_at:147:321; Interrogation_Position=1292; Antisense; GCGCTTCTTTTAACCAACACGTTCA
>probe:Drosophila_2:1636210_at:633:471; Interrogation_Position=1312; Antisense; GTTCAGTAGCCTTTGCCGCACATAA
>probe:Drosophila_2:1636210_at:92:719; Interrogation_Position=1348; Antisense; TTCCGCAGGTACTGGATGTGTCCAT
>probe:Drosophila_2:1636210_at:377:63; Interrogation_Position=1363; Antisense; ATGTGTCCATCGAATCTGGGTCGGA
>probe:Drosophila_2:1636210_at:297:549; Interrogation_Position=1463; Antisense; GGAGGGCATATACTCTTTATAGCCT
>probe:Drosophila_2:1636210_at:263:699; Interrogation_Position=1478; Antisense; TTTATAGCCTTCTAAGCTCCCTAAA
>probe:Drosophila_2:1636210_at:56:21; Interrogation_Position=1583; Antisense; ATATATCTGCTCCACTGTATGACGC

Paste this into a BLAST search page for me
GGCTTCCTCCAGTTGCGAAAGCAGTTGGCGTTTCCTCCAAACAGAGCGAATGACCTTAGTATCCGCATTGATCCGCTGGCCTATCAGCTCTCGGAAGAAAAAACTTTCAGGTGCTCGACAGTAAAGTAAACATTCGACGCAGCCGGAGAAGCTCGGTCACGGCATGGACTTCAAAGCGCTTCTTTTAACCAACACGTTCAGTTCAGTAGCCTTTGCCGCACATAATTCCGCAGGTACTGGATGTGTCCATATGTGTCCATCGAATCTGGGTCGGAGGAGGGCATATACTCTTTATAGCCTTTTATAGCCTTCTAAGCTCCCTAAAATATATCTGCTCCACTGTATGACGC

Full Affymetrix probeset data:

Annotations for 1636210_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime