FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636211_at:

>probe:Drosophila_2:1636211_at:424:441; Interrogation_Position=1043; Antisense; GATGGCAAGCTCTTTGCGTATGCTC
>probe:Drosophila_2:1636211_at:378:53; Interrogation_Position=1062; Antisense; ATGCTCTGGGCTACGATTGGTCCAA
>probe:Drosophila_2:1636211_at:136:543; Interrogation_Position=1102; Antisense; GGATTCCAGCATAAAACCCCACATA
>probe:Drosophila_2:1636211_at:446:9; Interrogation_Position=1126; Antisense; ATTCCTGCGCCCGTTTGAAACGAAT
>probe:Drosophila_2:1636211_at:87:369; Interrogation_Position=1147; Antisense; GAATGTTGCTGCCTAAATGCCGACT
>probe:Drosophila_2:1636211_at:602:97; Interrogation_Position=763; Antisense; AGATCTGACCAGCTGGCTTATTGCC
>probe:Drosophila_2:1636211_at:240:101; Interrogation_Position=813; Antisense; AGAGCATGGCTCATCGTACGGTCAG
>probe:Drosophila_2:1636211_at:95:487; Interrogation_Position=828; Antisense; GTACGGTCAGTTTTCCAATCAGGTG
>probe:Drosophila_2:1636211_at:179:239; Interrogation_Position=844; Antisense; AATCAGGTGCCATCGACGGGAGAAT
>probe:Drosophila_2:1636211_at:331:363; Interrogation_Position=865; Antisense; GAATTCCGGCATCCTAGACGTCTAT
>probe:Drosophila_2:1636211_at:188:409; Interrogation_Position=919; Antisense; GACGCAGCACATTGCCACGGTGGGA
>probe:Drosophila_2:1636211_at:537:433; Interrogation_Position=951; Antisense; GAGTGTTCTGCTTCTGGGACAGCCA
>probe:Drosophila_2:1636211_at:675:527; Interrogation_Position=966; Antisense; GGGACAGCCAGATGCGTTCCAAGCT
>probe:Drosophila_2:1636211_at:601:391; Interrogation_Position=995; Antisense; GAAAGCAAGGTTCATCCTCAGCCGA

Paste this into a BLAST search page for me
GATGGCAAGCTCTTTGCGTATGCTCATGCTCTGGGCTACGATTGGTCCAAGGATTCCAGCATAAAACCCCACATAATTCCTGCGCCCGTTTGAAACGAATGAATGTTGCTGCCTAAATGCCGACTAGATCTGACCAGCTGGCTTATTGCCAGAGCATGGCTCATCGTACGGTCAGGTACGGTCAGTTTTCCAATCAGGTGAATCAGGTGCCATCGACGGGAGAATGAATTCCGGCATCCTAGACGTCTATGACGCAGCACATTGCCACGGTGGGAGAGTGTTCTGCTTCTGGGACAGCCAGGGACAGCCAGATGCGTTCCAAGCTGAAAGCAAGGTTCATCCTCAGCCGA

Full Affymetrix probeset data:

Annotations for 1636211_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720