FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636212_at:

>probe:Drosophila_2:1636212_at:244:553; Interrogation_Position=1004; Antisense; GGAGCACCAGCCTTAATGGAACTAT
>probe:Drosophila_2:1636212_at:3:469; Interrogation_Position=553; Antisense; GTTGTTCTCACAACAGCCACTTGTT
>probe:Drosophila_2:1636212_at:147:127; Interrogation_Position=567; Antisense; AGCCACTTGTTTATCACCGGATCAA
>probe:Drosophila_2:1636212_at:146:545; Interrogation_Position=585; Antisense; GGATCAACCACTTGTCATAAGGGCT
>probe:Drosophila_2:1636212_at:77:413; Interrogation_Position=655; Antisense; GACCGCGATGTCCAATGTCGTATTG
>probe:Drosophila_2:1636212_at:635:179; Interrogation_Position=709; Antisense; AAACACAAACTTGCGCTTCTGGTCC
>probe:Drosophila_2:1636212_at:602:91; Interrogation_Position=743; Antisense; AGTTTCCACGGGTCCAGCATATGGA
>probe:Drosophila_2:1636212_at:121:423; Interrogation_Position=778; Antisense; GATAACTTCTTTGTCACCGGTTGGA
>probe:Drosophila_2:1636212_at:599:459; Interrogation_Position=821; Antisense; GATTATACCCGTCTCGGAACATTGT
>probe:Drosophila_2:1636212_at:275:713; Interrogation_Position=900; Antisense; TTCAGTGTTTACTTCTATTCCCCGA
>probe:Drosophila_2:1636212_at:359:131; Interrogation_Position=924; Antisense; ACCTGAGCAGCCCATGTATACCAAA
>probe:Drosophila_2:1636212_at:488:481; Interrogation_Position=939; Antisense; GTATACCAAAGGTGCTCCTCTAGTT
>probe:Drosophila_2:1636212_at:43:677; Interrogation_Position=959; Antisense; TAGTTTGTCCCACCGAGAGCAGCAA
>probe:Drosophila_2:1636212_at:620:29; Interrogation_Position=984; Antisense; ATACTATGTGGTTATGGCCTGGAGC

Paste this into a BLAST search page for me
GGAGCACCAGCCTTAATGGAACTATGTTGTTCTCACAACAGCCACTTGTTAGCCACTTGTTTATCACCGGATCAAGGATCAACCACTTGTCATAAGGGCTGACCGCGATGTCCAATGTCGTATTGAAACACAAACTTGCGCTTCTGGTCCAGTTTCCACGGGTCCAGCATATGGAGATAACTTCTTTGTCACCGGTTGGAGATTATACCCGTCTCGGAACATTGTTTCAGTGTTTACTTCTATTCCCCGAACCTGAGCAGCCCATGTATACCAAAGTATACCAAAGGTGCTCCTCTAGTTTAGTTTGTCCCACCGAGAGCAGCAAATACTATGTGGTTATGGCCTGGAGC

Full Affymetrix probeset data:

Annotations for 1636212_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720