FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636216_at:

>probe:Drosophila_2:1636216_at:352:355; Interrogation_Position=1005; Antisense; GCACATCCAGGCGTCGGTGCAGCAG
>probe:Drosophila_2:1636216_at:377:99; Interrogation_Position=1031; Antisense; AGATGCATCCGCAGTACCAGTACCA
>probe:Drosophila_2:1636216_at:340:487; Interrogation_Position=1050; Antisense; GTACCATGTGCACCAGCATCAGAAT
>probe:Drosophila_2:1636216_at:466:577; Interrogation_Position=1103; Antisense; TGGCCAACACGAGCGGTCCGTTCGG
>probe:Drosophila_2:1636216_at:195:333; Interrogation_Position=1134; Antisense; GCTGGCCAGCAGTGCCAGGGACTAT
>probe:Drosophila_2:1636216_at:486:547; Interrogation_Position=1161; Antisense; GGATGGACTGCATCATGCGGCCCAC
>probe:Drosophila_2:1636216_at:555:345; Interrogation_Position=1224; Antisense; GCATCATTCGCATCACACGGCATAC
>probe:Drosophila_2:1636216_at:41:129; Interrogation_Position=1304; Antisense; ACCATCTGCCATACTCGAAACTAGA
>probe:Drosophila_2:1636216_at:558:95; Interrogation_Position=1332; Antisense; AGATTACCCGAAACTGCCGCAAGAG
>probe:Drosophila_2:1636216_at:570:721; Interrogation_Position=1382; Antisense; TTGACGTAGACACGCTATCCCTAGA
>probe:Drosophila_2:1636216_at:46:303; Interrogation_Position=860; Antisense; CCGCCATTTCGCAGTACTACCAGAA
>probe:Drosophila_2:1636216_at:96:669; Interrogation_Position=874; Antisense; TACTACCAGAACCAGGGAGCCGCAA
>probe:Drosophila_2:1636216_at:506:615; Interrogation_Position=938; Antisense; TGCAGCAGCAGTTCGCGGGAACGCA
>probe:Drosophila_2:1636216_at:329:561; Interrogation_Position=955; Antisense; GGAACGCAACACTACGGCGGCGGAT

Paste this into a BLAST search page for me
GCACATCCAGGCGTCGGTGCAGCAGAGATGCATCCGCAGTACCAGTACCAGTACCATGTGCACCAGCATCAGAATTGGCCAACACGAGCGGTCCGTTCGGGCTGGCCAGCAGTGCCAGGGACTATGGATGGACTGCATCATGCGGCCCACGCATCATTCGCATCACACGGCATACACCATCTGCCATACTCGAAACTAGAAGATTACCCGAAACTGCCGCAAGAGTTGACGTAGACACGCTATCCCTAGACCGCCATTTCGCAGTACTACCAGAATACTACCAGAACCAGGGAGCCGCAATGCAGCAGCAGTTCGCGGGAACGCAGGAACGCAACACTACGGCGGCGGAT

Full Affymetrix probeset data:

Annotations for 1636216_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720