FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636217_at:

>probe:Drosophila_2:1636217_at:284:193; Interrogation_Position=166; Antisense; AACTACGATGACCTGGGCACTGAGC
>probe:Drosophila_2:1636217_at:724:143; Interrogation_Position=184; Antisense; ACTGAGCGCGAAGTGGACACGTGCT
>probe:Drosophila_2:1636217_at:111:217; Interrogation_Position=235; Antisense; AAGATTCCGCCGCTGGAGGAAGCCT
>probe:Drosophila_2:1636217_at:667:377; Interrogation_Position=253; Antisense; GAAGCCTTTGGCCTGAGAAACGACG
>probe:Drosophila_2:1636217_at:211:539; Interrogation_Position=278; Antisense; GGTTTTTCCCCATATTCTCGTGTGC
>probe:Drosophila_2:1636217_at:698:301; Interrogation_Position=354; Antisense; CCTGGCTCTTGGCAAAATCTACTTC
>probe:Drosophila_2:1636217_at:719:513; Interrogation_Position=391; Antisense; GTGTGCTTTGGCTACGGGCATCCCA
>probe:Drosophila_2:1636217_at:8:47; Interrogation_Position=410; Antisense; ATCCCATCGTTTCCTGCCAGGAGAA
>probe:Drosophila_2:1636217_at:609:69; Interrogation_Position=437; Antisense; AGGCCGACCTGTTCGAGACACGATG
>probe:Drosophila_2:1636217_at:230:105; Interrogation_Position=452; Antisense; AGACACGATGTCTCAGCTACCGAGT
>probe:Drosophila_2:1636217_at:621:643; Interrogation_Position=521; Antisense; TCTACACACACGTAAGCGGCAGCGA
>probe:Drosophila_2:1636217_at:130:437; Interrogation_Position=547; Antisense; GAGGACTCCCGAGATTGAACTTCGA
>probe:Drosophila_2:1636217_at:709:611; Interrogation_Position=562; Antisense; TGAACTTCGACGTCCGGCGATAAGC
>probe:Drosophila_2:1636217_at:681:573; Interrogation_Position=577; Antisense; GGCGATAAGCCCTCAATTGTTTACA

Paste this into a BLAST search page for me
AACTACGATGACCTGGGCACTGAGCACTGAGCGCGAAGTGGACACGTGCTAAGATTCCGCCGCTGGAGGAAGCCTGAAGCCTTTGGCCTGAGAAACGACGGGTTTTTCCCCATATTCTCGTGTGCCCTGGCTCTTGGCAAAATCTACTTCGTGTGCTTTGGCTACGGGCATCCCAATCCCATCGTTTCCTGCCAGGAGAAAGGCCGACCTGTTCGAGACACGATGAGACACGATGTCTCAGCTACCGAGTTCTACACACACGTAAGCGGCAGCGAGAGGACTCCCGAGATTGAACTTCGATGAACTTCGACGTCCGGCGATAAGCGGCGATAAGCCCTCAATTGTTTACA

Full Affymetrix probeset data:

Annotations for 1636217_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720