Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636218_at:

>probe:Drosophila_2:1636218_at:92:245; Interrogation_Position=1847; Antisense; AATTACCATATATCCCAAGCTAGAG
>probe:Drosophila_2:1636218_at:303:123; Interrogation_Position=1877; Antisense; AGCCAATCCGAAGGGCGATCAAGTC
>probe:Drosophila_2:1636218_at:284:171; Interrogation_Position=1922; Antisense; AAAGTCACCCAAGGATATGGCCAAG
>probe:Drosophila_2:1636218_at:260:681; Interrogation_Position=1937; Antisense; TATGGCCAAGCAGGTGTTCACAATG
>probe:Drosophila_2:1636218_at:727:711; Interrogation_Position=1953; Antisense; TTCACAATGGCCTCAGGAGCTGCTA
>probe:Drosophila_2:1636218_at:459:553; Interrogation_Position=1968; Antisense; GGAGCTGCTACTCTACTAACAGAAG
>probe:Drosophila_2:1636218_at:56:379; Interrogation_Position=1989; Antisense; GAAGCCACCAACACACTGGAGGACT
>probe:Drosophila_2:1636218_at:634:565; Interrogation_Position=2042; Antisense; GGCACTGGAACAGGCCTACACTTCG
>probe:Drosophila_2:1636218_at:364:169; Interrogation_Position=2071; Antisense; AAAGGCAGGCCCAAGGAGCTCTGGC
>probe:Drosophila_2:1636218_at:637:369; Interrogation_Position=2105; Antisense; GAAGGCCGTGGAAGCCGCCAACAAT
>probe:Drosophila_2:1636218_at:495:609; Interrogation_Position=2164; Antisense; TGAGCAGCCGAGATCGCGAGGCATT
>probe:Drosophila_2:1636218_at:138:575; Interrogation_Position=2195; Antisense; GGCCGAAAAGCATGCCATTTTGGCC
>probe:Drosophila_2:1636218_at:113:581; Interrogation_Position=2242; Antisense; TGGCCTTGAAGGACGAAATCGCTCG
>probe:Drosophila_2:1636218_at:11:237; Interrogation_Position=2258; Antisense; AATCGCTCGAGTTCTCAAGGATCTT

Paste this into a BLAST search page for me
AATTACCATATATCCCAAGCTAGAGAGCCAATCCGAAGGGCGATCAAGTCAAAGTCACCCAAGGATATGGCCAAGTATGGCCAAGCAGGTGTTCACAATGTTCACAATGGCCTCAGGAGCTGCTAGGAGCTGCTACTCTACTAACAGAAGGAAGCCACCAACACACTGGAGGACTGGCACTGGAACAGGCCTACACTTCGAAAGGCAGGCCCAAGGAGCTCTGGCGAAGGCCGTGGAAGCCGCCAACAATTGAGCAGCCGAGATCGCGAGGCATTGGCCGAAAAGCATGCCATTTTGGCCTGGCCTTGAAGGACGAAATCGCTCGAATCGCTCGAGTTCTCAAGGATCTT

Full Affymetrix probeset data:

Annotations for 1636218_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime