FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636219_at:

>probe:Drosophila_2:1636219_at:70:15; Interrogation_Position=6010; Antisense; ATTACCTGTATGTATTGGCCCGTTG
>probe:Drosophila_2:1636219_at:198:581; Interrogation_Position=6025; Antisense; TGGCCCGTTGTTCGATGTTGATCAA
>probe:Drosophila_2:1636219_at:294:139; Interrogation_Position=6083; Antisense; ACGATTGCTGATTGTGTTTCGCAGA
>probe:Drosophila_2:1636219_at:664:409; Interrogation_Position=6106; Antisense; GACGAAGATCTGTTGCCATATAAGC
>probe:Drosophila_2:1636219_at:330:449; Interrogation_Position=6182; Antisense; GATAATTTCGTCGTCTGTTTTTAGC
>probe:Drosophila_2:1636219_at:188:601; Interrogation_Position=6197; Antisense; TGTTTTTAGCTATTACATCGCAGTA
>probe:Drosophila_2:1636219_at:322:3; Interrogation_Position=6234; Antisense; ATTGGTTTCCCAGTGTAGCTTCATA
>probe:Drosophila_2:1636219_at:614:661; Interrogation_Position=6339; Antisense; TAAAATGTACCCCAGCAAACGACCG
>probe:Drosophila_2:1636219_at:7:219; Interrogation_Position=6366; Antisense; AAGTATGCACCAAAATGCTTGCCAT
>probe:Drosophila_2:1636219_at:85:167; Interrogation_Position=6378; Antisense; AAATGCTTGCCATACACACACAAAG
>probe:Drosophila_2:1636219_at:450:179; Interrogation_Position=6424; Antisense; AAAAAAGCTTTCACCACACTCACGC
>probe:Drosophila_2:1636219_at:149:187; Interrogation_Position=6530; Antisense; AACACACCTTTTGTGCAATGCAACA
>probe:Drosophila_2:1636219_at:655:357; Interrogation_Position=6549; Antisense; GCAACATTGCCAGTTTCTAATGGTA
>probe:Drosophila_2:1636219_at:696:707; Interrogation_Position=6577; Antisense; TTAAGCAGAACTCTATTTCCGCCAC

Paste this into a BLAST search page for me
ATTACCTGTATGTATTGGCCCGTTGTGGCCCGTTGTTCGATGTTGATCAAACGATTGCTGATTGTGTTTCGCAGAGACGAAGATCTGTTGCCATATAAGCGATAATTTCGTCGTCTGTTTTTAGCTGTTTTTAGCTATTACATCGCAGTAATTGGTTTCCCAGTGTAGCTTCATATAAAATGTACCCCAGCAAACGACCGAAGTATGCACCAAAATGCTTGCCATAAATGCTTGCCATACACACACAAAGAAAAAAGCTTTCACCACACTCACGCAACACACCTTTTGTGCAATGCAACAGCAACATTGCCAGTTTCTAATGGTATTAAGCAGAACTCTATTTCCGCCAC

Full Affymetrix probeset data:

Annotations for 1636219_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720