FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636220_at:

>probe:Drosophila_2:1636220_at:318:297; Interrogation_Position=269; Antisense; CGCATTGCTTTCTGGGACGGGTGAA
>probe:Drosophila_2:1636220_at:245:577; Interrogation_Position=319; Antisense; GGCGCCTCCAAGCTCAATGATAGAG
>probe:Drosophila_2:1636220_at:671:677; Interrogation_Position=339; Antisense; TAGAGGTATCCAGCGTCAAGTCAAG
>probe:Drosophila_2:1636220_at:288:563; Interrogation_Position=363; Antisense; GGAAGTTATCAAGTCGGCCGAATTT
>probe:Drosophila_2:1636220_at:608:221; Interrogation_Position=442; Antisense; AAGGGCAAGTCTCTCGGACAGCTGA
>probe:Drosophila_2:1636220_at:218:689; Interrogation_Position=541; Antisense; TTTGGCCCACAGAAACTATTGCGTA
>probe:Drosophila_2:1636220_at:616:179; Interrogation_Position=592; Antisense; AAAAAGTGTCGTGCTTCCTATCTGC
>probe:Drosophila_2:1636220_at:44:631; Interrogation_Position=607; Antisense; TCCTATCTGCCGACGGTTCATTTAA
>probe:Drosophila_2:1636220_at:676:263; Interrogation_Position=632; Antisense; CAGACAGTATGTTTTGCGCCGGAGT
>probe:Drosophila_2:1636220_at:15:173; Interrogation_Position=667; Antisense; AAAGATGCATGCACCTTTGACTCCG
>probe:Drosophila_2:1636220_at:263:289; Interrogation_Position=690; Antisense; CGGCGGTCCCTTGGTGTACAAGAAT
>probe:Drosophila_2:1636220_at:379:239; Interrogation_Position=712; Antisense; AATCAAGTATGTGGCATCGTGTCCT
>probe:Drosophila_2:1636220_at:630:99; Interrogation_Position=758; Antisense; AGAGATACTACGGTGTCTACACGGA
>probe:Drosophila_2:1636220_at:628:613; Interrogation_Position=794; Antisense; TGAAGCCCTTTATCGAGCAGAGCAT

Paste this into a BLAST search page for me
CGCATTGCTTTCTGGGACGGGTGAAGGCGCCTCCAAGCTCAATGATAGAGTAGAGGTATCCAGCGTCAAGTCAAGGGAAGTTATCAAGTCGGCCGAATTTAAGGGCAAGTCTCTCGGACAGCTGATTTGGCCCACAGAAACTATTGCGTAAAAAAGTGTCGTGCTTCCTATCTGCTCCTATCTGCCGACGGTTCATTTAACAGACAGTATGTTTTGCGCCGGAGTAAAGATGCATGCACCTTTGACTCCGCGGCGGTCCCTTGGTGTACAAGAATAATCAAGTATGTGGCATCGTGTCCTAGAGATACTACGGTGTCTACACGGATGAAGCCCTTTATCGAGCAGAGCAT

Full Affymetrix probeset data:

Annotations for 1636220_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720