FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636222_at:

>probe:Drosophila_2:1636222_at:662:547; Interrogation_Position=1600; Antisense; GGATGTCCCTGATAAGTTAGTACAG
>probe:Drosophila_2:1636222_at:395:215; Interrogation_Position=1613; Antisense; AAGTTAGTACAGTGTCTCGCGCCGG
>probe:Drosophila_2:1636222_at:497:573; Interrogation_Position=1636; Antisense; GGCTGCACACACATTTCTATCTATC
>probe:Drosophila_2:1636222_at:98:715; Interrogation_Position=1650; Antisense; TTCTATCTATCTATCGTTGGTTCTG
>probe:Drosophila_2:1636222_at:470:277; Interrogation_Position=1660; Antisense; CTATCGTTGGTTCTGTTTTATGTTT
>probe:Drosophila_2:1636222_at:516:543; Interrogation_Position=1691; Antisense; GGATTTGTTGCCTTAGTTTCTTTCT
>probe:Drosophila_2:1636222_at:402:697; Interrogation_Position=1711; Antisense; TTTCTCTCTGATTTGATTTGAACTG
>probe:Drosophila_2:1636222_at:387:459; Interrogation_Position=1725; Antisense; GATTTGAACTGAACTGACCTGATTG
>probe:Drosophila_2:1636222_at:580:383; Interrogation_Position=1735; Antisense; GAACTGACCTGATTGCATGCTTGCT
>probe:Drosophila_2:1636222_at:689:347; Interrogation_Position=1749; Antisense; GCATGCTTGCTCGAAACTCTAACTA
>probe:Drosophila_2:1636222_at:92:1; Interrogation_Position=1771; Antisense; CTAACTCTAACTCTTTAACCGTGCT
>probe:Drosophila_2:1636222_at:700:651; Interrogation_Position=1817; Antisense; TAATTTCTGATTTCCCTAACCCACT
>probe:Drosophila_2:1636222_at:714:313; Interrogation_Position=1846; Antisense; GCCATCTAACCAAGTTGCGTGCGAA
>probe:Drosophila_2:1636222_at:463:329; Interrogation_Position=1862; Antisense; GCGTGCGAAGTTCTGTATACCATAT

Paste this into a BLAST search page for me
GGATGTCCCTGATAAGTTAGTACAGAAGTTAGTACAGTGTCTCGCGCCGGGGCTGCACACACATTTCTATCTATCTTCTATCTATCTATCGTTGGTTCTGCTATCGTTGGTTCTGTTTTATGTTTGGATTTGTTGCCTTAGTTTCTTTCTTTTCTCTCTGATTTGATTTGAACTGGATTTGAACTGAACTGACCTGATTGGAACTGACCTGATTGCATGCTTGCTGCATGCTTGCTCGAAACTCTAACTACTAACTCTAACTCTTTAACCGTGCTTAATTTCTGATTTCCCTAACCCACTGCCATCTAACCAAGTTGCGTGCGAAGCGTGCGAAGTTCTGTATACCATAT

Full Affymetrix probeset data:

Annotations for 1636222_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720