Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636223_at:

>probe:Drosophila_2:1636223_at:488:237; Interrogation_Position=1007; Antisense; AATCGGGCGCCATCTTTGCCGAGGA
>probe:Drosophila_2:1636223_at:722:515; Interrogation_Position=1072; Antisense; GTGTCGCTGATCGAAATCGTCTCGG
>probe:Drosophila_2:1636223_at:55:545; Interrogation_Position=1095; Antisense; GGATCCGCCGGGTGTCTATACGAAG
>probe:Drosophila_2:1636223_at:204:397; Interrogation_Position=1135; Antisense; GACAAGTTTCGCATACGTCACTGCA
>probe:Drosophila_2:1636223_at:522:71; Interrogation_Position=1160; Antisense; AGGAACGGGATCTGGCTGCCTTGAA
>probe:Drosophila_2:1636223_at:31:573; Interrogation_Position=1173; Antisense; GGCTGCCTTGAAATACATCTGCGAC
>probe:Drosophila_2:1636223_at:222:159; Interrogation_Position=1204; Antisense; ACAAATCGTGCTGCCATGCTGGTGG
>probe:Drosophila_2:1636223_at:568:267; Interrogation_Position=1230; Antisense; CAGTGGAGTTTCCTGCCTCATTGAC
>probe:Drosophila_2:1636223_at:684:153; Interrogation_Position=1269; Antisense; ACAGATCTCGATCGCCGTGGATGGC
>probe:Drosophila_2:1636223_at:284:31; Interrogation_Position=1334; Antisense; ATAAGTACACCCGTTTGCTAGCCGA
>probe:Drosophila_2:1636223_at:155:721; Interrogation_Position=1348; Antisense; TTGCTAGCCGATCCCAATTACAACT
>probe:Drosophila_2:1636223_at:607:191; Interrogation_Position=1369; Antisense; AACTTCGAGTTTGTCATCACCCAGG
>probe:Drosophila_2:1636223_at:532:199; Interrogation_Position=886; Antisense; AACGAATACGATCGCCAGCTGGACA
>probe:Drosophila_2:1636223_at:438:471; Interrogation_Position=979; Antisense; GTTCGCATTATAGTGCTTCGCCTGA

Paste this into a BLAST search page for me
AATCGGGCGCCATCTTTGCCGAGGAGTGTCGCTGATCGAAATCGTCTCGGGGATCCGCCGGGTGTCTATACGAAGGACAAGTTTCGCATACGTCACTGCAAGGAACGGGATCTGGCTGCCTTGAAGGCTGCCTTGAAATACATCTGCGACACAAATCGTGCTGCCATGCTGGTGGCAGTGGAGTTTCCTGCCTCATTGACACAGATCTCGATCGCCGTGGATGGCATAAGTACACCCGTTTGCTAGCCGATTGCTAGCCGATCCCAATTACAACTAACTTCGAGTTTGTCATCACCCAGGAACGAATACGATCGCCAGCTGGACAGTTCGCATTATAGTGCTTCGCCTGA

Full Affymetrix probeset data:

Annotations for 1636223_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime