Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636225_at:

>probe:Drosophila_2:1636225_at:545:131; Interrogation_Position=1000; Antisense; ACCGAGTTCCACGATCGTCTGAATA
>probe:Drosophila_2:1636225_at:657:213; Interrogation_Position=1024; Antisense; AAGAGCTTCGACAGTGCCATGCTGG
>probe:Drosophila_2:1636225_at:50:67; Interrogation_Position=1114; Antisense; ATGGAAGACATACAGCTGCCGACAA
>probe:Drosophila_2:1636225_at:716:295; Interrogation_Position=1133; Antisense; CGACAATGAGCAGCCAGCACCAGTT
>probe:Drosophila_2:1636225_at:84:93; Interrogation_Position=1154; Antisense; AGTTCCTCATGCAACCGGCGGGCTT
>probe:Drosophila_2:1636225_at:137:369; Interrogation_Position=1193; Antisense; GAATGATCCATCAAATACGCCCCAC
>probe:Drosophila_2:1636225_at:631:27; Interrogation_Position=1207; Antisense; ATACGCCCCACATTGATTTGCATTG
>probe:Drosophila_2:1636225_at:460:419; Interrogation_Position=1301; Antisense; TCGTTTGGTTAACTTCTCACCTTAG
>probe:Drosophila_2:1636225_at:165:647; Interrogation_Position=1317; Antisense; TCACCTTAGTCTTAAGCCCCATAAA
>probe:Drosophila_2:1636225_at:546:365; Interrogation_Position=1420; Antisense; GAATACGATTCTGTGCTTAGCCATT
>probe:Drosophila_2:1636225_at:548:317; Interrogation_Position=884; Antisense; GCCGGGCAATATCCTTCAGCGATGG
>probe:Drosophila_2:1636225_at:380:165; Interrogation_Position=923; Antisense; AAATCCTGTCGAAGAGACGCCGCCA
>probe:Drosophila_2:1636225_at:445:585; Interrogation_Position=966; Antisense; TGGCAAGCGTTTCGCACTCAAGAAA
>probe:Drosophila_2:1636225_at:693:387; Interrogation_Position=987; Antisense; GAAAATCTCCATGACCGAGTTCCAC

Paste this into a BLAST search page for me
ACCGAGTTCCACGATCGTCTGAATAAAGAGCTTCGACAGTGCCATGCTGGATGGAAGACATACAGCTGCCGACAACGACAATGAGCAGCCAGCACCAGTTAGTTCCTCATGCAACCGGCGGGCTTGAATGATCCATCAAATACGCCCCACATACGCCCCACATTGATTTGCATTGTCGTTTGGTTAACTTCTCACCTTAGTCACCTTAGTCTTAAGCCCCATAAAGAATACGATTCTGTGCTTAGCCATTGCCGGGCAATATCCTTCAGCGATGGAAATCCTGTCGAAGAGACGCCGCCATGGCAAGCGTTTCGCACTCAAGAAAGAAAATCTCCATGACCGAGTTCCAC

Full Affymetrix probeset data:

Annotations for 1636225_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime