FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636227_at:

>probe:Drosophila_2:1636227_at:88:349; Interrogation_Position=1000; Antisense; GCAGGTCCTGCACTTGAACTACAAC
>probe:Drosophila_2:1636227_at:159:591; Interrogation_Position=1029; Antisense; TGGGTCCGACGGCAGTGAATCTCAT
>probe:Drosophila_2:1636227_at:266:681; Interrogation_Position=1100; Antisense; TATGGCAACCACTTTGACTCGCGTA
>probe:Drosophila_2:1636227_at:152:297; Interrogation_Position=1142; Antisense; CGCTTGCTGGATGCCGAGGTAGTAC
>probe:Drosophila_2:1636227_at:630:435; Interrogation_Position=1157; Antisense; GAGGTAGTACTCCACTCCGAGCTGG
>probe:Drosophila_2:1636227_at:728:13; Interrogation_Position=1215; Antisense; ATTACAGAGTGGTGCCTTGGCGTTA
>probe:Drosophila_2:1636227_at:165:185; Interrogation_Position=701; Antisense; AAAATTTCATCCGTGCTGAGCTCGC
>probe:Drosophila_2:1636227_at:354:109; Interrogation_Position=735; Antisense; AGAATACACTCTGGGCTCTTTCGCT
>probe:Drosophila_2:1636227_at:240:269; Interrogation_Position=782; Antisense; CAGGACATGATTCCCATTGCCGAGC
>probe:Drosophila_2:1636227_at:676:577; Interrogation_Position=810; Antisense; TGGCACGGACCAACTCGAAATTTCG
>probe:Drosophila_2:1636227_at:305:303; Interrogation_Position=848; Antisense; GCCTGCAACAAGATCGGTCCGGATG
>probe:Drosophila_2:1636227_at:429:415; Interrogation_Position=873; Antisense; GAGCCTTCTTTCTGCTGCGTGGAAT
>probe:Drosophila_2:1636227_at:248:429; Interrogation_Position=917; Antisense; GAGTTGCTGGACCTGAGCTACTGCT
>probe:Drosophila_2:1636227_at:438:419; Interrogation_Position=931; Antisense; GAGCTACTGCTCGATTGGTACGCAC

Paste this into a BLAST search page for me
GCAGGTCCTGCACTTGAACTACAACTGGGTCCGACGGCAGTGAATCTCATTATGGCAACCACTTTGACTCGCGTACGCTTGCTGGATGCCGAGGTAGTACGAGGTAGTACTCCACTCCGAGCTGGATTACAGAGTGGTGCCTTGGCGTTAAAAATTTCATCCGTGCTGAGCTCGCAGAATACACTCTGGGCTCTTTCGCTCAGGACATGATTCCCATTGCCGAGCTGGCACGGACCAACTCGAAATTTCGGCCTGCAACAAGATCGGTCCGGATGGAGCCTTCTTTCTGCTGCGTGGAATGAGTTGCTGGACCTGAGCTACTGCTGAGCTACTGCTCGATTGGTACGCAC

Full Affymetrix probeset data:

Annotations for 1636227_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720