FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636228_at:

>probe:Drosophila_2:1636228_at:148:79; Interrogation_Position=317; Antisense; AGGATATTGCCGAATCTCTGGCCGA
>probe:Drosophila_2:1636228_at:626:237; Interrogation_Position=346; Antisense; AATCTGGCCAGCAATATCCGTCAGG
>probe:Drosophila_2:1636228_at:694:651; Interrogation_Position=377; Antisense; TCAAGGTGGTGTCGCCACAGTTCGT
>probe:Drosophila_2:1636228_at:426:93; Interrogation_Position=395; Antisense; AGTTCGTTGACCAGCATCTGTTCCG
>probe:Drosophila_2:1636228_at:384:521; Interrogation_Position=438; Antisense; GGGCCACAACAATCACCAGGTGATC
>probe:Drosophila_2:1636228_at:266:331; Interrogation_Position=548; Antisense; GCGGCAATCCGGTGATCTACAAGAT
>probe:Drosophila_2:1636228_at:409:643; Interrogation_Position=563; Antisense; TCTACAAGATCAAGCCCTCGGTCAT
>probe:Drosophila_2:1636228_at:685:279; Interrogation_Position=579; Antisense; CTCGGTCATCTACCAACAGGAGGTG
>probe:Drosophila_2:1636228_at:109:81; Interrogation_Position=599; Antisense; AGGTGATCAACAAGGTGCCCACTCC
>probe:Drosophila_2:1636228_at:573:509; Interrogation_Position=646; Antisense; GTGAAGGTCTACAAGCCCGGCAAGA
>probe:Drosophila_2:1636228_at:420:305; Interrogation_Position=662; Antisense; CCGGCAAGAAGATCGAGGCTCCACT
>probe:Drosophila_2:1636228_at:243:667; Interrogation_Position=727; Antisense; TACAGCCAGCCCCAGGGTTATGGTA
>probe:Drosophila_2:1636228_at:677:65; Interrogation_Position=746; Antisense; ATGGTAGTGCCGGAGCTGCTTCCTC
>probe:Drosophila_2:1636228_at:414:357; Interrogation_Position=812; Antisense; GCAACGAGGCTCCACTGTACAACAG

Paste this into a BLAST search page for me
AGGATATTGCCGAATCTCTGGCCGAAATCTGGCCAGCAATATCCGTCAGGTCAAGGTGGTGTCGCCACAGTTCGTAGTTCGTTGACCAGCATCTGTTCCGGGGCCACAACAATCACCAGGTGATCGCGGCAATCCGGTGATCTACAAGATTCTACAAGATCAAGCCCTCGGTCATCTCGGTCATCTACCAACAGGAGGTGAGGTGATCAACAAGGTGCCCACTCCGTGAAGGTCTACAAGCCCGGCAAGACCGGCAAGAAGATCGAGGCTCCACTTACAGCCAGCCCCAGGGTTATGGTAATGGTAGTGCCGGAGCTGCTTCCTCGCAACGAGGCTCCACTGTACAACAG

Full Affymetrix probeset data:

Annotations for 1636228_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720