FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636231_at:

>probe:Drosophila_2:1636231_at:72:527; Interrogation_Position=314; Antisense; GGGCAACTACGACGTCAATGTGATC
>probe:Drosophila_2:1636231_at:600:529; Interrogation_Position=391; Antisense; GGGATCCACACTGTCTCAATCTGAG
>probe:Drosophila_2:1636231_at:471:237; Interrogation_Position=408; Antisense; AATCTGAGCGTCATTTTCGGCTTCA
>probe:Drosophila_2:1636231_at:314:695; Interrogation_Position=422; Antisense; TTTCGGCTTCATTCTCAATGTACCG
>probe:Drosophila_2:1636231_at:284:143; Interrogation_Position=496; Antisense; ACTGGCTGGCACTGCGTCGCTTGAA
>probe:Drosophila_2:1636231_at:579:633; Interrogation_Position=512; Antisense; TCGCTTGAACGGCAGCTACTACAAT
>probe:Drosophila_2:1636231_at:442:147; Interrogation_Position=529; Antisense; ACTACAATCTGGACTCCAAGCTGCG
>probe:Drosophila_2:1636231_at:111:221; Interrogation_Position=561; Antisense; AAGTGCCTGGGCACCGAGCAGCAGT
>probe:Drosophila_2:1636231_at:39:419; Interrogation_Position=576; Antisense; GAGCAGCAGTTCCTCGAGTTTCTGG
>probe:Drosophila_2:1636231_at:549:193; Interrogation_Position=607; Antisense; AACTGCAGATGGATCACGAGCTATT
>probe:Drosophila_2:1636231_at:385:137; Interrogation_Position=622; Antisense; ACGAGCTATTCCTCGTGTTGGACGA
>probe:Drosophila_2:1636231_at:360:335; Interrogation_Position=683; Antisense; GCTGCTACCGCAGTTCAGGGATTAA
>probe:Drosophila_2:1636231_at:249:663; Interrogation_Position=813; Antisense; TAAACCTTTACCATCCATTTTGCAC
>probe:Drosophila_2:1636231_at:607:689; Interrogation_Position=831; Antisense; TTTGCACTGCAAGTGGAAGCCACCA

Paste this into a BLAST search page for me
GGGCAACTACGACGTCAATGTGATCGGGATCCACACTGTCTCAATCTGAGAATCTGAGCGTCATTTTCGGCTTCATTTCGGCTTCATTCTCAATGTACCGACTGGCTGGCACTGCGTCGCTTGAATCGCTTGAACGGCAGCTACTACAATACTACAATCTGGACTCCAAGCTGCGAAGTGCCTGGGCACCGAGCAGCAGTGAGCAGCAGTTCCTCGAGTTTCTGGAACTGCAGATGGATCACGAGCTATTACGAGCTATTCCTCGTGTTGGACGAGCTGCTACCGCAGTTCAGGGATTAATAAACCTTTACCATCCATTTTGCACTTTGCACTGCAAGTGGAAGCCACCA

Full Affymetrix probeset data:

Annotations for 1636231_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720