FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636232_at:

>probe:Drosophila_2:1636232_at:395:573; Interrogation_Position=128; Antisense; GGCTGCTGCACGTGAATCAGGCTCA
>probe:Drosophila_2:1636232_at:353:35; Interrogation_Position=143; Antisense; ATCAGGCTCATCAGGACGATCGCGG
>probe:Drosophila_2:1636232_at:155:557; Interrogation_Position=156; Antisense; GGACGATCGCGGCTACTATATGTGC
>probe:Drosophila_2:1636232_at:422:185; Interrogation_Position=187; Antisense; AACACCAACCCGATGATTAGCCAAG
>probe:Drosophila_2:1636232_at:718:219; Interrogation_Position=209; Antisense; AAGTGGGCTACCTACAGGTGGTCGT
>probe:Drosophila_2:1636232_at:474:243; Interrogation_Position=295; Antisense; AATATCAACATGACGTGCCGGGCCG
>probe:Drosophila_2:1636232_at:413:87; Interrogation_Position=397; Antisense; AGTCGCAATGAAATGGGCGCCTATT
>probe:Drosophila_2:1636232_at:225:693; Interrogation_Position=420; Antisense; TTTGTGCATCGCCACCAATGGAGTA
>probe:Drosophila_2:1636232_at:418:253; Interrogation_Position=459; Antisense; CAAGCGGATCATTCTGGACGTGGAG
>probe:Drosophila_2:1636232_at:68:589; Interrogation_Position=519; Antisense; TGGAGTGCATCGTGCCAACCAAACA
>probe:Drosophila_2:1636232_at:350:43; Interrogation_Position=551; Antisense; ATCCTGGGTATCTGGTTTTCGTGCC
>probe:Drosophila_2:1636232_at:244:695; Interrogation_Position=567; Antisense; TTTCGTGCCATATTCCTTCATGGAG
>probe:Drosophila_2:1636232_at:207:281; Interrogation_Position=622; Antisense; CTCATCAATTTAACTGCACGCTCGT
>probe:Drosophila_2:1636232_at:223:129; Interrogation_Position=64; Antisense; ACCATCCACCGGCATGTGATATCAA

Paste this into a BLAST search page for me
GGCTGCTGCACGTGAATCAGGCTCAATCAGGCTCATCAGGACGATCGCGGGGACGATCGCGGCTACTATATGTGCAACACCAACCCGATGATTAGCCAAGAAGTGGGCTACCTACAGGTGGTCGTAATATCAACATGACGTGCCGGGCCGAGTCGCAATGAAATGGGCGCCTATTTTTGTGCATCGCCACCAATGGAGTACAAGCGGATCATTCTGGACGTGGAGTGGAGTGCATCGTGCCAACCAAACAATCCTGGGTATCTGGTTTTCGTGCCTTTCGTGCCATATTCCTTCATGGAGCTCATCAATTTAACTGCACGCTCGTACCATCCACCGGCATGTGATATCAA

Full Affymetrix probeset data:

Annotations for 1636232_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720