FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636233_at:

>probe:Drosophila_2:1636233_at:526:177; Interrogation_Position=103; Antisense; AAACTGAATCGATTGGCCACGGAAT
>probe:Drosophila_2:1636233_at:126:523; Interrogation_Position=128; Antisense; GGGCCAATTATTTGCTGTCCAGAAA
>probe:Drosophila_2:1636233_at:243:605; Interrogation_Position=186; Antisense; TGAGAACATTTACATGGCCTCCGGG
>probe:Drosophila_2:1636233_at:712:235; Interrogation_Position=214; Antisense; AATCTGAAAGGTGCCGATGCCGTCA
>probe:Drosophila_2:1636233_at:487:445; Interrogation_Position=229; Antisense; GATGCCGTCAGATCCTGGTACGAAG
>probe:Drosophila_2:1636233_at:643:583; Interrogation_Position=271; Antisense; TGGAATTCTCCGTCGTTTCAAGGTA
>probe:Drosophila_2:1636233_at:645:711; Interrogation_Position=287; Antisense; TTCAAGGTAACACCGGCCATTTCAC
>probe:Drosophila_2:1636233_at:431:315; Interrogation_Position=302; Antisense; GCCATTTCACTCAGGTGGTCTGGAA
>probe:Drosophila_2:1636233_at:309:589; Interrogation_Position=317; Antisense; TGGTCTGGAAGAGCTCCACCGAGCT
>probe:Drosophila_2:1636233_at:327:521; Interrogation_Position=362; Antisense; GTGGCAGTACCATCTATGTTGTGTG
>probe:Drosophila_2:1636233_at:686:371; Interrogation_Position=37; Antisense; GAAGTTCTTCAAGCCCACAATTTAT
>probe:Drosophila_2:1636233_at:585:145; Interrogation_Position=416; Antisense; ACTTGTTCAGGGAGAATGTCGCACC
>probe:Drosophila_2:1636233_at:129:687; Interrogation_Position=59; Antisense; TATATCGGGCCAAGCATGGTGCTCA
>probe:Drosophila_2:1636233_at:142:651; Interrogation_Position=81; Antisense; TCAACCCTTGACTTTGAGTCCCAAA

Paste this into a BLAST search page for me
AAACTGAATCGATTGGCCACGGAATGGGCCAATTATTTGCTGTCCAGAAATGAGAACATTTACATGGCCTCCGGGAATCTGAAAGGTGCCGATGCCGTCAGATGCCGTCAGATCCTGGTACGAAGTGGAATTCTCCGTCGTTTCAAGGTATTCAAGGTAACACCGGCCATTTCACGCCATTTCACTCAGGTGGTCTGGAATGGTCTGGAAGAGCTCCACCGAGCTGTGGCAGTACCATCTATGTTGTGTGGAAGTTCTTCAAGCCCACAATTTATACTTGTTCAGGGAGAATGTCGCACCTATATCGGGCCAAGCATGGTGCTCATCAACCCTTGACTTTGAGTCCCAAA

Full Affymetrix probeset data:

Annotations for 1636233_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720