FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636234_at:

>probe:Drosophila_2:1636234_at:685:239; Interrogation_Position=1013; Antisense; AATTTCATTTGGAGGCACCAGGCCG
>probe:Drosophila_2:1636234_at:561:155; Interrogation_Position=1043; Antisense; ACACTGGCAGTTGCAGGACTTTCCT
>probe:Drosophila_2:1636234_at:176:265; Interrogation_Position=1081; Antisense; CAGTCCCAGTTCCACTAACTTAAAG
>probe:Drosophila_2:1636234_at:361:385; Interrogation_Position=1137; Antisense; GAAAAGGACCTCTGGATCCCATAGG
>probe:Drosophila_2:1636234_at:660:109; Interrogation_Position=1206; Antisense; AGAAGTTATCTGACGCACTGAGCGA
>probe:Drosophila_2:1636234_at:603:135; Interrogation_Position=1218; Antisense; ACGCACTGAGCGATATGTCCATAGA
>probe:Drosophila_2:1636234_at:372:65; Interrogation_Position=1246; Antisense; ATGGTAATCCTCTAGCGACAGCACA
>probe:Drosophila_2:1636234_at:586:587; Interrogation_Position=750; Antisense; TGGAGCCCTTTCTGCGGAACGATAT
>probe:Drosophila_2:1636234_at:426:35; Interrogation_Position=776; Antisense; ATCACCAGCTTGCAGATCTCCGAGT
>probe:Drosophila_2:1636234_at:480:37; Interrogation_Position=791; Antisense; ATCTCCGAGTTGGATCTCAGTTTCG
>probe:Drosophila_2:1636234_at:541:421; Interrogation_Position=815; Antisense; GAGAATACTCTGAATGCCATGGTGA
>probe:Drosophila_2:1636234_at:497:577; Interrogation_Position=844; Antisense; GGCCTGCTCGCGAAGGGACGACAAT
>probe:Drosophila_2:1636234_at:115:231; Interrogation_Position=866; Antisense; AATGTCCGCATGCTATATGACCAAA
>probe:Drosophila_2:1636234_at:582:171; Interrogation_Position=972; Antisense; AAAGATTGCGCGCTCTAGCCGAGGA

Paste this into a BLAST search page for me
AATTTCATTTGGAGGCACCAGGCCGACACTGGCAGTTGCAGGACTTTCCTCAGTCCCAGTTCCACTAACTTAAAGGAAAAGGACCTCTGGATCCCATAGGAGAAGTTATCTGACGCACTGAGCGAACGCACTGAGCGATATGTCCATAGAATGGTAATCCTCTAGCGACAGCACATGGAGCCCTTTCTGCGGAACGATATATCACCAGCTTGCAGATCTCCGAGTATCTCCGAGTTGGATCTCAGTTTCGGAGAATACTCTGAATGCCATGGTGAGGCCTGCTCGCGAAGGGACGACAATAATGTCCGCATGCTATATGACCAAAAAAGATTGCGCGCTCTAGCCGAGGA

Full Affymetrix probeset data:

Annotations for 1636234_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720