FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636235_at:

>probe:Drosophila_2:1636235_at:646:311; Interrogation_Position=374; Antisense; GCCAGGAAGAAGAGTCCCCGGACCA
>probe:Drosophila_2:1636235_at:164:673; Interrogation_Position=491; Antisense; TACCGCAACCAGGAGGCGTCTTGGA
>probe:Drosophila_2:1636235_at:212:627; Interrogation_Position=561; Antisense; TGCCTGGCGCGACAATTTCTATGAA
>probe:Drosophila_2:1636235_at:567:117; Interrogation_Position=601; Antisense; AGCTATATCTTTGGCTACTCCATTC
>probe:Drosophila_2:1636235_at:530:307; Interrogation_Position=627; Antisense; CCATGGCATTCGTCGCTGGGAGAAG
>probe:Drosophila_2:1636235_at:370:221; Interrogation_Position=649; Antisense; AAGGGCTACTATTCGGAGGAGCAGC
>probe:Drosophila_2:1636235_at:462:517; Interrogation_Position=682; Antisense; GTGGTTGAGGGCTTCTATGTCCAGC
>probe:Drosophila_2:1636235_at:404:267; Interrogation_Position=721; Antisense; CAGGGCCTGAGATATGAGCTTCGAT
>probe:Drosophila_2:1636235_at:399:419; Interrogation_Position=736; Antisense; GAGCTTCGATGCTACAGAGCCGATT
>probe:Drosophila_2:1636235_at:426:103; Interrogation_Position=751; Antisense; AGAGCCGATTCCGAGGGCTATCAGC
>probe:Drosophila_2:1636235_at:422:277; Interrogation_Position=768; Antisense; CTATCAGCCGCGTCCAGTTGAGTTT
>probe:Drosophila_2:1636235_at:116:95; Interrogation_Position=783; Antisense; AGTTGAGTTTCTGAGGACGCCGCCA
>probe:Drosophila_2:1636235_at:347:5; Interrogation_Position=808; Antisense; ATTGTGAGGCGCGATGCCATACCGC
>probe:Drosophila_2:1636235_at:644:671; Interrogation_Position=827; Antisense; TACCGCGTGTTAATTGCTTCCAAAA

Paste this into a BLAST search page for me
GCCAGGAAGAAGAGTCCCCGGACCATACCGCAACCAGGAGGCGTCTTGGATGCCTGGCGCGACAATTTCTATGAAAGCTATATCTTTGGCTACTCCATTCCCATGGCATTCGTCGCTGGGAGAAGAAGGGCTACTATTCGGAGGAGCAGCGTGGTTGAGGGCTTCTATGTCCAGCCAGGGCCTGAGATATGAGCTTCGATGAGCTTCGATGCTACAGAGCCGATTAGAGCCGATTCCGAGGGCTATCAGCCTATCAGCCGCGTCCAGTTGAGTTTAGTTGAGTTTCTGAGGACGCCGCCAATTGTGAGGCGCGATGCCATACCGCTACCGCGTGTTAATTGCTTCCAAAA

Full Affymetrix probeset data:

Annotations for 1636235_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720