Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636236_at:

>probe:Drosophila_2:1636236_at:562:43; Interrogation_Position=2245; Antisense; ATCCGAGAGCGGGAAACGGTCGTCT
>probe:Drosophila_2:1636236_at:234:259; Interrogation_Position=2271; Antisense; CACGGCAGTCAAGTTCGGCACGGAA
>probe:Drosophila_2:1636236_at:658:323; Interrogation_Position=2328; Antisense; GCGCTCGAATTTTGCCGCTGAAAAG
>probe:Drosophila_2:1636236_at:492:169; Interrogation_Position=2349; Antisense; AAAGGAATCACTGCTGACCGCCTTG
>probe:Drosophila_2:1636236_at:172:719; Interrogation_Position=2392; Antisense; TTCGCCCTGCAGAGAGTCCTTATAT
>probe:Drosophila_2:1636236_at:265:191; Interrogation_Position=2460; Antisense; AACATTCAAGGCTGTGGTCTCCAAC
>probe:Drosophila_2:1636236_at:38:195; Interrogation_Position=2482; Antisense; AACTCCATGGGCTATCGATTGGCCA
>probe:Drosophila_2:1636236_at:719:487; Interrogation_Position=2511; Antisense; GTACGTGTCCGTCAATATGCAGAAC
>probe:Drosophila_2:1636236_at:442:723; Interrogation_Position=2547; Antisense; TTGCAGCAACTCAACCGACAAGGTT
>probe:Drosophila_2:1636236_at:186:491; Interrogation_Position=2572; Antisense; GTAAATCTGATGACACCGCTAATTG
>probe:Drosophila_2:1636236_at:195:655; Interrogation_Position=2591; Antisense; TAATTGAATGTCTGTCCACTCCGAA
>probe:Drosophila_2:1636236_at:419:427; Interrogation_Position=2647; Antisense; GAGATCCTACGCGACATGAACGGCA
>probe:Drosophila_2:1636236_at:727:525; Interrogation_Position=2703; Antisense; GGGCAACGATAACATCCACTGGCAG
>probe:Drosophila_2:1636236_at:679:67; Interrogation_Position=2753; Antisense; AGGCCATTCGGGACATAATCCTGTG

Paste this into a BLAST search page for me
ATCCGAGAGCGGGAAACGGTCGTCTCACGGCAGTCAAGTTCGGCACGGAAGCGCTCGAATTTTGCCGCTGAAAAGAAAGGAATCACTGCTGACCGCCTTGTTCGCCCTGCAGAGAGTCCTTATATAACATTCAAGGCTGTGGTCTCCAACAACTCCATGGGCTATCGATTGGCCAGTACGTGTCCGTCAATATGCAGAACTTGCAGCAACTCAACCGACAAGGTTGTAAATCTGATGACACCGCTAATTGTAATTGAATGTCTGTCCACTCCGAAGAGATCCTACGCGACATGAACGGCAGGGCAACGATAACATCCACTGGCAGAGGCCATTCGGGACATAATCCTGTG

Full Affymetrix probeset data:

Annotations for 1636236_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime