Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636238_at:

>probe:Drosophila_2:1636238_at:273:255; Interrogation_Position=1732; Antisense; CAAAATCGCGATTAGCCCTTGTTTA
>probe:Drosophila_2:1636238_at:467:327; Interrogation_Position=1739; Antisense; GCGATTAGCCCTTGTTTATTAGTAC
>probe:Drosophila_2:1636238_at:469:325; Interrogation_Position=1768; Antisense; GCGACAGATCAAGAGCGACAGGAAT
>probe:Drosophila_2:1636238_at:43:403; Interrogation_Position=1811; Antisense; GACTTGAGCACTTCACAAATTTATG
>probe:Drosophila_2:1636238_at:59:393; Interrogation_Position=1867; Antisense; GAAACCTGCTAGAGAAACATCATTT
>probe:Drosophila_2:1636238_at:512:195; Interrogation_Position=1905; Antisense; AACTGTGATTCAAGCGAATGCAGCA
>probe:Drosophila_2:1636238_at:48:211; Interrogation_Position=1953; Antisense; AAGCAAATGCTATACCCAGCTCTCA
>probe:Drosophila_2:1636238_at:207:341; Interrogation_Position=1961; Antisense; GCTATACCCAGCTCTCATACAAAGA
>probe:Drosophila_2:1636238_at:134:137; Interrogation_Position=2083; Antisense; ACGACCAATGTCAAATTGTTTGCTC
>probe:Drosophila_2:1636238_at:299:617; Interrogation_Position=2103; Antisense; TGCTCAAAACGACGCAATTGGCACA
>probe:Drosophila_2:1636238_at:222:475; Interrogation_Position=2132; Antisense; GTTAACCTTTGTAGTAGTGTGAATA
>probe:Drosophila_2:1636238_at:492:367; Interrogation_Position=2163; Antisense; GAATCTGGCGCTCAATTGTGATAAA
>probe:Drosophila_2:1636238_at:373:425; Interrogation_Position=2224; Antisense; GAGAGCTAGATCCTCGTTCGCTAAG
>probe:Drosophila_2:1636238_at:241:205; Interrogation_Position=2246; Antisense; AAGCGCCGCCATTTGTGTAGTTTAA

Paste this into a BLAST search page for me
CAAAATCGCGATTAGCCCTTGTTTAGCGATTAGCCCTTGTTTATTAGTACGCGACAGATCAAGAGCGACAGGAATGACTTGAGCACTTCACAAATTTATGGAAACCTGCTAGAGAAACATCATTTAACTGTGATTCAAGCGAATGCAGCAAAGCAAATGCTATACCCAGCTCTCAGCTATACCCAGCTCTCATACAAAGAACGACCAATGTCAAATTGTTTGCTCTGCTCAAAACGACGCAATTGGCACAGTTAACCTTTGTAGTAGTGTGAATAGAATCTGGCGCTCAATTGTGATAAAGAGAGCTAGATCCTCGTTCGCTAAGAAGCGCCGCCATTTGTGTAGTTTAA

Full Affymetrix probeset data:

Annotations for 1636238_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime