FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636240_at:

>probe:Drosophila_2:1636240_at:288:685; Interrogation_Position=2194; Antisense; TATCACTGAGGTAGCCGAAGCGCAT
>probe:Drosophila_2:1636240_at:658:443; Interrogation_Position=2254; Antisense; GATGAGCGAAATCTGGATCCACCAG
>probe:Drosophila_2:1636240_at:432:69; Interrogation_Position=2277; Antisense; AGGCCATCCACACAATCGAGTATAT
>probe:Drosophila_2:1636240_at:334:483; Interrogation_Position=2296; Antisense; GTATATCCTTAGTACCATCTCACAC
>probe:Drosophila_2:1636240_at:539:645; Interrogation_Position=2327; Antisense; TCATATCTTCGTCTCTGGGCCTTGT
>probe:Drosophila_2:1636240_at:660:117; Interrogation_Position=2356; Antisense; AGCTCATGCCCAGCTATCGGAGGTG
>probe:Drosophila_2:1636240_at:5:323; Interrogation_Position=2430; Antisense; GCGCCATTGGGCTGTTTTTCATCTT
>probe:Drosophila_2:1636240_at:65:699; Interrogation_Position=2444; Antisense; TTTTTCATCTTTGCCGTTTGGGAGT
>probe:Drosophila_2:1636240_at:210:527; Interrogation_Position=2463; Antisense; GGGAGTTTTTCACCATCGCTATCAT
>probe:Drosophila_2:1636240_at:513:647; Interrogation_Position=2490; Antisense; TCATGATGGAGGGTCTTTCCGCCTT
>probe:Drosophila_2:1636240_at:690:157; Interrogation_Position=2520; Antisense; ACACATTGCGCTTGCACTGGGTGGA
>probe:Drosophila_2:1636240_at:555:473; Interrogation_Position=2581; Antisense; GTTCACGCCATTCAGCTTTAAGGAT
>probe:Drosophila_2:1636240_at:128:109; Interrogation_Position=2631; Antisense; AGAACCATCAGGATAGCCATCGTGA
>probe:Drosophila_2:1636240_at:11:271; Interrogation_Position=2648; Antisense; CATCGTGATTCGCTCCTTGAAGAAG

Paste this into a BLAST search page for me
TATCACTGAGGTAGCCGAAGCGCATGATGAGCGAAATCTGGATCCACCAGAGGCCATCCACACAATCGAGTATATGTATATCCTTAGTACCATCTCACACTCATATCTTCGTCTCTGGGCCTTGTAGCTCATGCCCAGCTATCGGAGGTGGCGCCATTGGGCTGTTTTTCATCTTTTTTTCATCTTTGCCGTTTGGGAGTGGGAGTTTTTCACCATCGCTATCATTCATGATGGAGGGTCTTTCCGCCTTACACATTGCGCTTGCACTGGGTGGAGTTCACGCCATTCAGCTTTAAGGATAGAACCATCAGGATAGCCATCGTGACATCGTGATTCGCTCCTTGAAGAAG

Full Affymetrix probeset data:

Annotations for 1636240_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720