FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636242_at:

>probe:Drosophila_2:1636242_at:4:299; Interrogation_Position=120; Antisense; CGCACCCACGGAATACGAACAGAGA
>probe:Drosophila_2:1636242_at:671:101; Interrogation_Position=140; Antisense; AGAGACGCATGATGTGCTCCACCGG
>probe:Drosophila_2:1636242_at:612:497; Interrogation_Position=15; Antisense; GGTTCTCAAAGTGCCGACGTCCAAA
>probe:Drosophila_2:1636242_at:432:129; Interrogation_Position=160; Antisense; ACCGGCCTCAGCGATGTGATACAGA
>probe:Drosophila_2:1636242_at:372:49; Interrogation_Position=189; Antisense; ATGCGTAAGCGGAACGGTGGCCCTT
>probe:Drosophila_2:1636242_at:551:521; Interrogation_Position=205; Antisense; GTGGCCCTTGGCGATGTATTTCCCA
>probe:Drosophila_2:1636242_at:216:575; Interrogation_Position=214; Antisense; GGCGATGTATTTCCCAACAGTTTCG
>probe:Drosophila_2:1636242_at:425:189; Interrogation_Position=229; Antisense; AACAGTTTCGGGAAGCGCAGGAAGC
>probe:Drosophila_2:1636242_at:606:321; Interrogation_Position=252; Antisense; GCGCGACTTGCAGAACGTAACCGAT
>probe:Drosophila_2:1636242_at:348:383; Interrogation_Position=264; Antisense; GAACGTAACCGATTTGTGCTGCAAG
>probe:Drosophila_2:1636242_at:561:615; Interrogation_Position=283; Antisense; TGCAAGTCGGGTGGCTGCACCTACA
>probe:Drosophila_2:1636242_at:729:353; Interrogation_Position=299; Antisense; GCACCTACAGGGAGCTCTTGCAGTA
>probe:Drosophila_2:1636242_at:171:409; Interrogation_Position=30; Antisense; GACGTCCAAAGTCCTGCTAGTCCTG
>probe:Drosophila_2:1636242_at:596:605; Interrogation_Position=80; Antisense; TGATCAGCAGCTGGATGCCCCAGGT

Paste this into a BLAST search page for me
CGCACCCACGGAATACGAACAGAGAAGAGACGCATGATGTGCTCCACCGGGGTTCTCAAAGTGCCGACGTCCAAAACCGGCCTCAGCGATGTGATACAGAATGCGTAAGCGGAACGGTGGCCCTTGTGGCCCTTGGCGATGTATTTCCCAGGCGATGTATTTCCCAACAGTTTCGAACAGTTTCGGGAAGCGCAGGAAGCGCGCGACTTGCAGAACGTAACCGATGAACGTAACCGATTTGTGCTGCAAGTGCAAGTCGGGTGGCTGCACCTACAGCACCTACAGGGAGCTCTTGCAGTAGACGTCCAAAGTCCTGCTAGTCCTGTGATCAGCAGCTGGATGCCCCAGGT

Full Affymetrix probeset data:

Annotations for 1636242_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720