FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636243_at:

>probe:Drosophila_2:1636243_at:482:127; Interrogation_Position=1062; Antisense; AGCCACTGCTGAACTCGACGCAGTT
>probe:Drosophila_2:1636243_at:37:71; Interrogation_Position=1092; Antisense; AGGCCTTCACGTACCTTATCCAGAA
>probe:Drosophila_2:1636243_at:615:357; Interrogation_Position=1141; Antisense; GCACAAGGCCTACCTGAACGGCTGT
>probe:Drosophila_2:1636243_at:405:383; Interrogation_Position=1156; Antisense; GAACGGCTGTTCCAATCTACTGCTG
>probe:Drosophila_2:1636243_at:695:405; Interrogation_Position=1181; Antisense; GACTCCAGCTCCACATATCAATAAA
>probe:Drosophila_2:1636243_at:268:191; Interrogation_Position=1217; Antisense; AACATTTCCGAATTGCAGCCCATAT
>probe:Drosophila_2:1636243_at:665:353; Interrogation_Position=1231; Antisense; GCAGCCCATATTTTCATTTGTTCGC
>probe:Drosophila_2:1636243_at:511:293; Interrogation_Position=1264; Antisense; CGAGTTCAAGCCGAGTTAATTTACA
>probe:Drosophila_2:1636243_at:692:673; Interrogation_Position=1297; Antisense; TAGCTGTAAGCCGACAAGGGCAGTC
>probe:Drosophila_2:1636243_at:428:313; Interrogation_Position=749; Antisense; GCCACGCCTGGCGAGGATCTGTTGC
>probe:Drosophila_2:1636243_at:703:81; Interrogation_Position=785; Antisense; AGGGACAATCACGAGAGCCGGCTGT
>probe:Drosophila_2:1636243_at:712:351; Interrogation_Position=829; Antisense; GCAGCTTAACATTCAGCTCCTGAGC
>probe:Drosophila_2:1636243_at:142:663; Interrogation_Position=868; Antisense; TAAAAGCTACGCTACGGCTCAATCT
>probe:Drosophila_2:1636243_at:352:251; Interrogation_Position=943; Antisense; CAAGTGCTTGCGGAGACTGCTGGCT

Paste this into a BLAST search page for me
AGCCACTGCTGAACTCGACGCAGTTAGGCCTTCACGTACCTTATCCAGAAGCACAAGGCCTACCTGAACGGCTGTGAACGGCTGTTCCAATCTACTGCTGGACTCCAGCTCCACATATCAATAAAAACATTTCCGAATTGCAGCCCATATGCAGCCCATATTTTCATTTGTTCGCCGAGTTCAAGCCGAGTTAATTTACATAGCTGTAAGCCGACAAGGGCAGTCGCCACGCCTGGCGAGGATCTGTTGCAGGGACAATCACGAGAGCCGGCTGTGCAGCTTAACATTCAGCTCCTGAGCTAAAAGCTACGCTACGGCTCAATCTCAAGTGCTTGCGGAGACTGCTGGCT

Full Affymetrix probeset data:

Annotations for 1636243_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720