FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636245_at:

>probe:Drosophila_2:1636245_at:241:429; Interrogation_Position=1878; Antisense; GAGTTCTACAAGCTGGGCTTTCGAC
>probe:Drosophila_2:1636245_at:468:571; Interrogation_Position=1893; Antisense; GGCTTTCGACCGCAGGACGAGATCA
>probe:Drosophila_2:1636245_at:438:97; Interrogation_Position=1912; Antisense; AGATCACCACGGAGCTGTAACCGCA
>probe:Drosophila_2:1636245_at:80:419; Interrogation_Position=1923; Antisense; GAGCTGTAACCGCATCACAAAACTC
>probe:Drosophila_2:1636245_at:373:355; Interrogation_Position=1964; Antisense; GCAAACTAAGTATTACCCCGGCTGG
>probe:Drosophila_2:1636245_at:92:675; Interrogation_Position=1995; Antisense; TAGCCGTTCGAGTCTAGCGCCAGTT
>probe:Drosophila_2:1636245_at:41:565; Interrogation_Position=2028; Antisense; GGAATGGAGCATTTGCGTGCACATT
>probe:Drosophila_2:1636245_at:416:723; Interrogation_Position=2040; Antisense; TTGCGTGCACATTCCGACAGGCCAT
>probe:Drosophila_2:1636245_at:724:399; Interrogation_Position=2055; Antisense; GACAGGCCATCATCGACTTCGACAA
>probe:Drosophila_2:1636245_at:714:393; Interrogation_Position=2075; Antisense; GACAAGCTAACTGGGAGGCCGTTTA
>probe:Drosophila_2:1636245_at:548:673; Interrogation_Position=2098; Antisense; TAGCCGGAGCCGCTAAATGCCCACG
>probe:Drosophila_2:1636245_at:10:235; Interrogation_Position=2113; Antisense; AATGCCCACGCTTAGAGCTTAGTTA
>probe:Drosophila_2:1636245_at:118:177; Interrogation_Position=2362; Antisense; AAACGCGATACTTATAGCTATAGCT
>probe:Drosophila_2:1636245_at:716:183; Interrogation_Position=2433; Antisense; AAAATCGTGTGCCTTAGGATTGTAA

Paste this into a BLAST search page for me
GAGTTCTACAAGCTGGGCTTTCGACGGCTTTCGACCGCAGGACGAGATCAAGATCACCACGGAGCTGTAACCGCAGAGCTGTAACCGCATCACAAAACTCGCAAACTAAGTATTACCCCGGCTGGTAGCCGTTCGAGTCTAGCGCCAGTTGGAATGGAGCATTTGCGTGCACATTTTGCGTGCACATTCCGACAGGCCATGACAGGCCATCATCGACTTCGACAAGACAAGCTAACTGGGAGGCCGTTTATAGCCGGAGCCGCTAAATGCCCACGAATGCCCACGCTTAGAGCTTAGTTAAAACGCGATACTTATAGCTATAGCTAAAATCGTGTGCCTTAGGATTGTAA

Full Affymetrix probeset data:

Annotations for 1636245_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720