Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1636246_a_at:

>probe:Drosophila_2:1636246_a_at:34:371; Interrogation_Position=215; Antisense; GAAGTGGTTTCATCGTACCGTCCCT
>probe:Drosophila_2:1636246_a_at:130:35; Interrogation_Position=290; Antisense; ATCAGCGCCTGGTACTGGCTACGCG
>probe:Drosophila_2:1636246_a_at:258:661; Interrogation_Position=339; Antisense; TAACGGAGTCCCTCTGGATTCATCC
>probe:Drosophila_2:1636246_a_at:144:81; Interrogation_Position=380; Antisense; ACCCTAACATTGGTCGTCCTGTTCA
>probe:Drosophila_2:1636246_a_at:703:503; Interrogation_Position=395; Antisense; GTCCTGTTCATCCTGGGCATACAGA
>probe:Drosophila_2:1636246_a_at:67:391; Interrogation_Position=418; Antisense; GAAACTAGTCATAGCTCCGCAAATA
>probe:Drosophila_2:1636246_a_at:445:381; Interrogation_Position=453; Antisense; GAACGCGAATGGTACTGGGAGACTT
>probe:Drosophila_2:1636246_a_at:296:377; Interrogation_Position=502; Antisense; GAAGCTGATACTCAAGCCGCGGCAA
>probe:Drosophila_2:1636246_a_at:471:159; Interrogation_Position=534; Antisense; ACAACAGTACATGAGCACCGGCCAG
>probe:Drosophila_2:1636246_a_at:571:577; Interrogation_Position=553; Antisense; GGCCAGCTTCCAGGACGTTTATTTA
>probe:Drosophila_2:1636246_a_at:180:277; Interrogation_Position=613; Antisense; CTACATGTTGATTCGGACACCCTCG
>probe:Drosophila_2:1636246_a_at:149:399; Interrogation_Position=628; Antisense; GACACCCTCGCTTTGTAAGCGTATT
>probe:Drosophila_2:1636246_a_at:150:703; Interrogation_Position=666; Antisense; TTATTTCTCCCCTACACATTTTGTT
>probe:Drosophila_2:1636246_a_at:579:579; Interrogation_Position=753; Antisense; TGTGTTTCGTTAATGGCGTTACCCA

Paste this into a BLAST search page for me
GAAGTGGTTTCATCGTACCGTCCCTATCAGCGCCTGGTACTGGCTACGCGTAACGGAGTCCCTCTGGATTCATCCACCCTAACATTGGTCGTCCTGTTCAGTCCTGTTCATCCTGGGCATACAGAGAAACTAGTCATAGCTCCGCAAATAGAACGCGAATGGTACTGGGAGACTTGAAGCTGATACTCAAGCCGCGGCAAACAACAGTACATGAGCACCGGCCAGGGCCAGCTTCCAGGACGTTTATTTACTACATGTTGATTCGGACACCCTCGGACACCCTCGCTTTGTAAGCGTATTTTATTTCTCCCCTACACATTTTGTTTGTGTTTCGTTAATGGCGTTACCCA

Full Affymetrix probeset data:

Annotations for 1636246_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime